Incidental Mutation 'RF044:Igf1r'
ID 604960
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms line 186, A330103N21Rik, CD221, hyft, IGF-1R
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF044 (G1)
Quality Score 214.463
Status Not validated
Chromosome 7
Chromosomal Location 67952827-68233668 bp(+) (GRCm38)
Type of Mutation small insertion (4 aa in frame mutation)
DNA Base Change (assembly) GATGGAGC to GATGGAGCTGGATATGGAGC at 68226179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005671
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533

Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TG TGTGGCTGCCG 1: 82,913,589 probably benign Het
Blm CTCC CTCCTCCTCCTCATCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Ccdc85c GCC GCCACC 12: 108,274,612 probably benign Het
Chga AGC AGCGGC 12: 102,561,396 probably benign Het
Crtam TTCTTGATCTGAA T 9: 40,984,354 probably null Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,768 probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,299,938 probably benign Het
Gab3 TCT TCTCCT X: 75,000,005 probably benign Het
Gabre CTC CTCCGGATC X: 72,270,061 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,131 probably benign Het
Lrmp TG TGAGCACATCG 6: 145,173,790 probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Morn4 GTGAG GTGAGTCAAGCATTGAG 19: 42,076,114 probably null Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr964-ps1 AAAATA AAAATAAATA 9: 39,686,747 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pla2g4e AGGG A 2: 120,244,724 probably benign Het
Ptdss1 G T 13: 66,945,348 S84I possibly damaging Het
Ren1 ACCGC AC 1: 133,350,781 probably benign Het
Rinl G T 7: 28,797,563 G496V probably damaging Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sbp A AAAAAGATGATGACAC 17: 23,945,366 probably benign Het
Spaca1 TCTCGC TCTCGCGCTCGC 4: 34,049,846 probably benign Het
Spaca1 TCGC TCGCTCGCGC 4: 34,049,854 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 GCA GCAACA 11: 94,214,461 probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 134,058,874 probably benign Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Hungarian UTSW 7 68214997 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Romanian UTSW 7 68004137 missense possibly damaging 0.94
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7923:Igf1r UTSW 7 68190101 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
R8368:Igf1r UTSW 7 68187048 missense probably benign 0.03
R8458:Igf1r UTSW 7 68195629 missense probably benign
R8539:Igf1r UTSW 7 68003848 missense probably benign 0.06
R8704:Igf1r UTSW 7 68170054 splice site probably benign
R8746:Igf1r UTSW 7 68214997 missense probably damaging 1.00
R8829:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8832:Igf1r UTSW 7 68226021 missense probably damaging 1.00
R8859:Igf1r UTSW 7 68183463 missense possibly damaging 0.75
R9057:Igf1r UTSW 7 68183438 missense probably damaging 1.00
R9243:Igf1r UTSW 7 68212027 missense probably benign 0.11
R9342:Igf1r UTSW 7 68194998 missense probably benign 0.00
R9412:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R9525:Igf1r UTSW 7 68214934 missense probably damaging 1.00
R9727:Igf1r UTSW 7 68207806 missense probably damaging 1.00
R9730:Igf1r UTSW 7 68189675 missense probably damaging 1.00
R9779:Igf1r UTSW 7 68004317 missense probably damaging 1.00
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
Z1186:Igf1r UTSW 7 68226168 small insertion probably benign
Z1186:Igf1r UTSW 7 68226169 small insertion probably benign
Z1186:Igf1r UTSW 7 68226174 small insertion probably benign
Z1186:Igf1r UTSW 7 68226180 small insertion probably benign
Z1186:Igf1r UTSW 7 68226182 small insertion probably benign
Z1191:Igf1r UTSW 7 68226169 small insertion probably benign
Z1191:Igf1r UTSW 7 68226170 small insertion probably benign
Z1191:Igf1r UTSW 7 68226173 small insertion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04