Incidental Mutation 'RF044:Strn'
ID604977
Institutional Source Beutler Lab
Gene Symbol Strn
Ensembl Gene ENSMUSG00000024077
Gene Namestriatin, calmodulin binding protein
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #RF044 (G1)
Quality Score161.468
Status Not validated
Chromosome17
Chromosomal Location78649913-78737196 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) C to CCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTA at 78677288 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024881] [ENSMUST00000145910]
Predicted Effect probably null
Transcript: ENSMUST00000024881
SMART Domains Protein: ENSMUSP00000024881
Gene: ENSMUSG00000024077

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
low complexity region 178 195 N/A INTRINSIC
low complexity region 223 231 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
WD40 299 338 6.04e-8 SMART
WD40 352 391 2.42e-7 SMART
WD40 405 444 1.21e-7 SMART
WD40 493 539 1.28e1 SMART
WD40 542 581 4.4e-10 SMART
WD40 584 627 2.48e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000145480
SMART Domains Protein: ENSMUSP00000117663
Gene: ENSMUSG00000024077

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
low complexity region 153 171 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000145910
SMART Domains Protein: ENSMUSP00000120830
Gene: ENSMUSG00000024077

DomainStartEndE-ValueType
low complexity region 17 45 N/A INTRINSIC
Pfam:Striatin 48 177 4.2e-50 PFAM
low complexity region 238 254 N/A INTRINSIC
low complexity region 331 348 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 412 429 N/A INTRINSIC
WD40 452 491 6.04e-8 SMART
WD40 505 544 2.42e-7 SMART
WD40 558 597 1.21e-7 SMART
WD40 646 692 1.28e1 SMART
WD40 695 734 4.4e-10 SMART
WD40 737 780 2.48e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit increased blood pressure and circulating aldosterone when fed a liberal salt diet. No mice could be generated that were homozygous for the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TG TGTGGCTGCCG 1: 82,913,589 probably benign Het
Blm CTCC CTCCTCCTCCTCATCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,057 probably null Het
Ccdc85c GCC GCCACC 12: 108,274,612 probably benign Het
Chga AGC AGCGGC 12: 102,561,396 probably benign Het
Crtam TTCTTGATCTGAA T 9: 40,984,354 probably null Het
Dspp TGACAGCAGCGACAGCAG TGACAGCAGCGACAGCAGAGACAGCAGCGACAGCAG 5: 104,178,424 probably benign Het
Efhd2 CCGCCG CCGCCGACGCCG 4: 141,874,768 probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,299,938 probably benign Het
Gab3 TCT TCTCCT X: 75,000,005 probably benign Het
Gabre CTC CTCCGGATC X: 72,270,061 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Haus4 AGGGCAGGCCGCTGGCCACACACCTGGGAGGGGGGCAGGCCGCTGGCCACACACCTGGGAGGGGGGCAGGCCGCTGGCCACACACCTGGGAG AGGGCAGGCCGCTGGCCACACACCTGGGAGGGGGGCAGGCCGCTGGCCACACACCTGGGAG 14: 54,544,120 probably null Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 CCACAG CCACAGACACAG 1: 83,042,131 probably benign Het
Lrmp TG TGAGCACATCG 6: 145,173,790 probably benign Het
Maml2 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA 9: 13,621,456 probably benign Het
Map1a CAGCTCCAGCTCCAGCTCCAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAAGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,293 probably benign Het
Mapk6 CCAC CCACCTCAC 9: 75,388,260 probably null Het
Morn4 GTGAG GTGAGTCAAGCATTGAG 19: 42,076,114 probably null Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA CTTGGCCTCACCTGGGGAATTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA 11: 4,941,016 probably benign Het
Nefh CCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGACTCACCTGGGGACTTGGCCTCACCTGGGGACTTGG 11: 4,941,021 probably benign Het
Nefh TCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,023 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr964-ps1 AAAATA AAAATAAATA 9: 39,686,747 probably null Het
Phc1 TG TGCTGCGG 6: 122,323,600 probably benign Het
Pla2g4e AGGG A 2: 120,244,724 probably benign Het
Prr36 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC 8: 4,216,273 probably benign Het
Ptdss1 G T 13: 66,945,348 S84I possibly damaging Het
Ren1 ACCGC AC 1: 133,350,781 probably benign Het
Rinl G T 7: 28,797,563 G496V probably damaging Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sbp A AAAAAGATGATGACAC 17: 23,945,366 probably benign Het
Slc39a4 GTC GTCATCATGATCACCATGGTCACCATGATCACTGTGTTC 15: 76,614,870 probably benign Het
Spaca1 TCTCGC TCTCGCGCTCGC 4: 34,049,846 probably benign Het
Spaca1 TCGC TCGCTCGCGC 4: 34,049,854 probably benign Het
Thegl ATCCTCCCCAGTCCCGCAAGGCCAG ATCCTCCCCAGTCCCGCAAGGCCAGCGCTCCTCCCCAGTCCCGCAAGGCCAG 5: 77,016,405 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Tob1 GCA GCAACA 11: 94,214,461 probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 134,058,874 probably benign Het
Other mutations in Strn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Strn APN 17 78692420 missense possibly damaging 0.89
IGL02165:Strn APN 17 78687620 missense probably damaging 1.00
IGL02424:Strn APN 17 78684351 missense probably damaging 1.00
IGL02473:Strn APN 17 78684293 missense possibly damaging 0.71
IGL03306:Strn APN 17 78667223 missense probably damaging 0.98
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0165:Strn UTSW 17 78677374 missense possibly damaging 0.89
R1156:Strn UTSW 17 78656931 missense probably damaging 0.99
R1191:Strn UTSW 17 78692426 missense possibly damaging 0.82
R1256:Strn UTSW 17 78664617 critical splice donor site probably null
R1700:Strn UTSW 17 78692402 missense probably damaging 1.00
R1878:Strn UTSW 17 78677326 missense possibly damaging 0.81
R1897:Strn UTSW 17 78682842 missense probably benign 0.01
R1912:Strn UTSW 17 78684395 missense probably damaging 1.00
R1975:Strn UTSW 17 78692499 intron probably null
R2357:Strn UTSW 17 78655599 missense probably damaging 1.00
R3054:Strn UTSW 17 78682892 missense probably damaging 0.99
R3693:Strn UTSW 17 78656992 missense probably damaging 1.00
R3694:Strn UTSW 17 78656992 missense probably damaging 1.00
R3695:Strn UTSW 17 78656992 missense probably damaging 1.00
R3941:Strn UTSW 17 78657940 missense probably damaging 0.99
R4431:Strn UTSW 17 78736462 missense probably damaging 1.00
R4570:Strn UTSW 17 78677372 missense possibly damaging 0.95
R4678:Strn UTSW 17 78677351 missense probably damaging 1.00
R4729:Strn UTSW 17 78657961 missense probably damaging 0.98
R4947:Strn UTSW 17 78661779 missense probably damaging 0.98
R5470:Strn UTSW 17 78656945 missense probably benign 0.01
R5710:Strn UTSW 17 78687599 missense probably damaging 1.00
R5943:Strn UTSW 17 78669847 missense probably damaging 0.96
R6173:Strn UTSW 17 78700869 missense probably damaging 1.00
R6800:Strn UTSW 17 78670358 intron probably benign
R6846:Strn UTSW 17 78736457 missense probably damaging 0.97
R7716:Strn UTSW 17 78655775 missense probably damaging 0.99
R7746:Strn UTSW 17 78677372 missense probably benign 0.11
RF006:Strn UTSW 17 78677271 frame shift probably null
RF008:Strn UTSW 17 78677287 frame shift probably null
RF017:Strn UTSW 17 78677288 frame shift probably null
RF018:Strn UTSW 17 78677283 frame shift probably null
RF031:Strn UTSW 17 78677277 frame shift probably null
RF035:Strn UTSW 17 78677285 frame shift probably null
RF036:Strn UTSW 17 78677277 frame shift probably null
RF038:Strn UTSW 17 78677282 frame shift probably null
RF039:Strn UTSW 17 78677278 frame shift probably null
RF045:Strn UTSW 17 78677282 frame shift probably null
RF047:Strn UTSW 17 78677270 frame shift probably null
RF047:Strn UTSW 17 78677274 frame shift probably null
RF048:Strn UTSW 17 78677287 frame shift probably null
X0022:Strn UTSW 17 78700949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGCTTCCTTATGGCTC -3'
(R):5'- GAACACAATGTGTCTGGCTG -3'

Sequencing Primer
(F):5'- TCTCGCCCAGCCTAGACAG -3'
(R):5'- AACACAATGTGTCTGGCTGAGTTAG -3'
Posted On2019-12-04