Incidental Mutation 'RF045:1500015O10Rik'
ID604985
Institutional Source Beutler Lab
Gene Symbol 1500015O10Rik
Ensembl Gene ENSMUSG00000026051
Gene NameRIKEN cDNA 1500015O10 gene
SynonymsEcrg4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF045 (G1)
Quality Score214.458
Status Not validated
Chromosome1
Chromosomal Location43730602-43742578 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) TTCTGTA to T at 43737192 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027217]
Predicted Effect probably benign
Transcript: ENSMUST00000027217
SMART Domains Protein: ENSMUSP00000027217
Gene: ENSMUSG00000026051

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Augurin 32 148 2.9e-56 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: No notable pheontype was detected in high throughput screens of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGCCG 19: 5,425,218 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Cdsn CAGC CAGCAGCTCTCAGTCAGGAAGTAGC 17: 35,554,968 probably benign Het
Cyb5r4 ATGT ATGTGAGACACACTGCCCAGGGATGTGT 9: 87,040,402 probably null Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGAA 9: 87,040,447 probably benign Het
Cyp4a12b C T 4: 115,432,493 H186Y probably benign Het
Dbr1 AAGAGGA AAGAGGAAGAGGA 9: 99,583,671 probably benign Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGCGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Dnmt1 TACCTCGTT TACCTCGTTTTGGGGGCGGAGCACAGTTCCCACCTCGTT 9: 20,910,137 probably benign Het
Fam71e1 GGAGGA GGAGGAAGGCTGGATCCTGGATACCTGGGTCTGAGTGAGGA 7: 44,500,532 probably null Het
Gabre CCGGCT CCGGCTGCGGCT X: 72,270,045 probably benign Het
Gabre CTCAGGCT C X: 72,270,181 probably null Het
Iqcf4 TTCCTTTTCCTTTT TTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTATCCTTTTCCTTTT 9: 106,570,610 probably benign Het
Kcnq3 CCGCCAGCCGC CC 15: 66,286,184 probably benign Het
Krtap28-10 CCACAG CCACAGTCACAG 1: 83,042,143 probably benign Het
Krtap28-10 CACAGCCACCACAGCCACAGCCACCACAGC CACAGCCACCACAGCAACAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,261 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,292 probably benign Het
Map1a CAGCTCCAGCTCCAGCTCC CAGCTCCAGCTCCAGCTCCCGCTCCAGCTCTAGCTCCAGCTCCAGCTCC 2: 121,306,293 probably benign Het
Ncapd2 ACT ACTACACGCCGTCAGAGCACCGTGTTCTGTCACATCCT 6: 125,179,236 probably null Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Ntn4 G T 10: 93,710,625 R380L possibly damaging Het
Nusap1 A ATACACGTTAGCAGTGAGGAGCAAGCTGAGG 2: 119,627,610 probably benign Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Ptms CTCCTC CTCCTCCTC 6: 124,914,450 probably benign Het
Snx1 CTGTT CTGTTGTT 9: 66,104,922 probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACACCAGTC 17: 78,677,282 probably null Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,727,666 probably benign Het
Other mutations in 1500015O10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:1500015O10Rik APN 1 43730951 missense probably damaging 0.99
R0543:1500015O10Rik UTSW 1 43742289 missense possibly damaging 0.95
R2149:1500015O10Rik UTSW 1 43742336 missense probably damaging 1.00
R4621:1500015O10Rik UTSW 1 43737252 splice site probably null
R4622:1500015O10Rik UTSW 1 43742321 missense possibly damaging 0.79
R5940:1500015O10Rik UTSW 1 43737241 nonsense probably null
R6648:1500015O10Rik UTSW 1 43738691 missense probably damaging 1.00
R6776:1500015O10Rik UTSW 1 43742391 missense probably damaging 1.00
RF007:1500015O10Rik UTSW 1 43737192 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGTAATGCCCTTGTCATCTATTCG -3'
(R):5'- CAGGTCTGCAAGCCTTTCTC -3'

Sequencing Primer
(F):5'- ATCAGTATTAGCCCTCGATACCATG -3'
(R):5'- AGGTCTGCAAGCCTTTCTCATATTC -3'
Posted On2019-12-04