Incidental Mutation 'RF045:Nusap1'
ID604988
Institutional Source Beutler Lab
Gene Symbol Nusap1
Ensembl Gene ENSMUSG00000027306
Gene Namenucleolar and spindle associated protein 1
Synonyms2610201A12Rik, NuSAP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF045 (G1)
Quality Score217.468
Status Not validated
Chromosome2
Chromosomal Location119618298-119651244 bp(+) (GRCm38)
Type of Mutationsmall insertion (10 aa in frame mutation)
DNA Base Change (assembly) A to ATACACGTTAGCAGTGAGGAGCAAGCTGAGG at 119627610 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028771] [ENSMUST00000068225]
Predicted Effect probably benign
Transcript: ENSMUST00000028771
SMART Domains Protein: ENSMUSP00000028771
Gene: ENSMUSG00000027306

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
coiled coil region 360 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068225
SMART Domains Protein: ENSMUSP00000068713
Gene: ENSMUSG00000027306

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
Pfam:NUSAP 167 261 6e-27 PFAM
Pfam:NUSAP 256 421 2.3e-72 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 [PubMed 12963707]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Early embryos homozygous for a knock-out allele are small and exhibit disorganized embryonic tissue, abnormal chromatin-induced spindle assembly, abnormal inner cell mass apoptosis, and complete embryonic lethality at implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik TTCTGTA T 1: 43,737,192 probably benign Het
AI837181 GCG GCGCCG 19: 5,425,218 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Cdsn CAGC CAGCAGCTCTCAGTCAGGAAGTAGC 17: 35,554,968 probably benign Het
Cyb5r4 ATGT ATGTGAGACACACTGCCCAGGGATGTGT 9: 87,040,402 probably null Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGAA 9: 87,040,447 probably benign Het
Cyp4a12b C T 4: 115,432,493 H186Y probably benign Het
Dbr1 AAGAGGA AAGAGGAAGAGGA 9: 99,583,671 probably benign Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGCGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Dnmt1 TACCTCGTT TACCTCGTTTTGGGGGCGGAGCACAGTTCCCACCTCGTT 9: 20,910,137 probably benign Het
Fam71e1 GGAGGA GGAGGAAGGCTGGATCCTGGATACCTGGGTCTGAGTGAGGA 7: 44,500,532 probably null Het
Gabre CCGGCT CCGGCTGCGGCT X: 72,270,045 probably benign Het
Gabre CTCAGGCT C X: 72,270,181 probably null Het
Iqcf4 TTCCTTTTCCTTTT TTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTATCCTTTTCCTTTT 9: 106,570,610 probably benign Het
Kcnq3 CCGCCAGCCGC CC 15: 66,286,184 probably benign Het
Krtap28-10 CCACAG CCACAGTCACAG 1: 83,042,143 probably benign Het
Krtap28-10 CACAGCCACCACAGCCACAGCCACCACAGC CACAGCCACCACAGCAACAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,261 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,292 probably benign Het
Map1a CAGCTCCAGCTCCAGCTCC CAGCTCCAGCTCCAGCTCCCGCTCCAGCTCTAGCTCCAGCTCCAGCTCC 2: 121,306,293 probably benign Het
Ncapd2 ACT ACTACACGCCGTCAGAGCACCGTGTTCTGTCACATCCT 6: 125,179,236 probably null Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Ntn4 G T 10: 93,710,625 R380L possibly damaging Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Ptms CTCCTC CTCCTCCTC 6: 124,914,450 probably benign Het
Snx1 CTGTT CTGTTGTT 9: 66,104,922 probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACACCAGTC 17: 78,677,282 probably null Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,727,666 probably benign Het
Other mutations in Nusap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Nusap1 APN 2 119648890 splice site probably benign
IGL02582:Nusap1 APN 2 119648989 makesense probably null
IGL02732:Nusap1 APN 2 119635580 missense probably damaging 0.96
IGL02794:Nusap1 APN 2 119630386 missense possibly damaging 0.80
R0635:Nusap1 UTSW 2 119627667 missense probably damaging 0.98
R2567:Nusap1 UTSW 2 119643830 missense possibly damaging 0.70
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3895:Nusap1 UTSW 2 119627691 missense possibly damaging 0.94
R4296:Nusap1 UTSW 2 119639648 missense probably damaging 1.00
R5111:Nusap1 UTSW 2 119630356 nonsense probably null
R5417:Nusap1 UTSW 2 119647143 missense probably damaging 0.98
R5754:Nusap1 UTSW 2 119647099 missense probably damaging 1.00
R5818:Nusap1 UTSW 2 119635513 missense possibly damaging 0.85
R6176:Nusap1 UTSW 2 119630421 missense probably benign 0.01
R7947:Nusap1 UTSW 2 119647135 missense possibly damaging 0.95
RF003:Nusap1 UTSW 2 119627603 small insertion probably benign
RF007:Nusap1 UTSW 2 119627581 small insertion probably benign
RF010:Nusap1 UTSW 2 119627584 small insertion probably benign
RF016:Nusap1 UTSW 2 119627601 small insertion probably benign
RF018:Nusap1 UTSW 2 119627578 small insertion probably benign
RF026:Nusap1 UTSW 2 119627590 small insertion probably benign
RF026:Nusap1 UTSW 2 119627604 small insertion probably benign
RF028:Nusap1 UTSW 2 119627578 small insertion probably benign
RF028:Nusap1 UTSW 2 119627591 small insertion probably benign
RF029:Nusap1 UTSW 2 119627594 small insertion probably benign
RF029:Nusap1 UTSW 2 119627605 small insertion probably benign
RF032:Nusap1 UTSW 2 119627587 small insertion probably benign
RF033:Nusap1 UTSW 2 119627600 small insertion probably benign
RF035:Nusap1 UTSW 2 119627579 small insertion probably benign
RF036:Nusap1 UTSW 2 119627587 small insertion probably benign
RF036:Nusap1 UTSW 2 119627594 small insertion probably benign
RF037:Nusap1 UTSW 2 119627589 small insertion probably benign
RF040:Nusap1 UTSW 2 119627587 small insertion probably benign
RF041:Nusap1 UTSW 2 119627579 small insertion probably benign
RF041:Nusap1 UTSW 2 119627593 small insertion probably benign
RF041:Nusap1 UTSW 2 119627607 nonsense probably null
RF042:Nusap1 UTSW 2 119627607 nonsense probably null
RF043:Nusap1 UTSW 2 119627592 small insertion probably benign
RF046:Nusap1 UTSW 2 119627595 nonsense probably null
RF048:Nusap1 UTSW 2 119627599 small insertion probably benign
RF049:Nusap1 UTSW 2 119627583 small insertion probably benign
RF052:Nusap1 UTSW 2 119627584 small insertion probably benign
RF056:Nusap1 UTSW 2 119627581 small insertion probably benign
RF056:Nusap1 UTSW 2 119627586 small insertion probably benign
RF056:Nusap1 UTSW 2 119627591 small insertion probably benign
RF062:Nusap1 UTSW 2 119627601 small insertion probably benign
RF062:Nusap1 UTSW 2 119627610 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATTGCAAGTGCTAGTTCGTTATCTG -3'
(R):5'- TACTTCTGAGGAGCCTGCAG -3'

Sequencing Primer
(F):5'- AGTTCGTTATCTGTGACAAGTTCC -3'
(R):5'- TCCAGTCATCTAGCATCATGAAGG -3'
Posted On2019-12-04