Incidental Mutation 'R0128:Ubap2l'
ID60499
Institutional Source Beutler Lab
Gene Symbol Ubap2l
Ensembl Gene ENSMUSG00000042520
Gene Nameubiquitin-associated protein 2-like
SynonymsA430103N23Rik, NICE-4, 3110083O19Rik, 4932431F02Rik
MMRRC Submission 038413-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0128 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90000140-90052628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90021373 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 478 (S478T)
Ref Sequence ENSEMBL: ENSMUSP00000066138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000090908] [ENSMUST00000195995] [ENSMUST00000196843] [ENSMUST00000198322] [ENSMUST00000199834]
Predicted Effect probably benign
Transcript: ENSMUST00000029553
AA Change: S473T

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520
AA Change: S473T

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000064639
AA Change: S478T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520
AA Change: S478T

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000090908
AA Change: S453T
SMART Domains Protein: ENSMUSP00000088424
Gene: ENSMUSG00000042520
AA Change: S453T

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195995
AA Change: S484T

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143638
Gene: ENSMUSG00000042520
AA Change: S484T

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 526 557 3.7e-18 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196568
Predicted Effect probably benign
Transcript: ENSMUST00000196843
AA Change: S473T

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520
AA Change: S473T

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196952
Predicted Effect probably benign
Transcript: ENSMUST00000197177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197633
Predicted Effect probably benign
Transcript: ENSMUST00000198322
AA Change: S453T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520
AA Change: S453T

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199612
Predicted Effect probably benign
Transcript: ENSMUST00000199834
AA Change: S484T

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143254
Gene: ENSMUSG00000042520
AA Change: S484T

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200320
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased female body size and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,575,639 probably benign Het
Abcd4 T G 12: 84,612,352 Q210P possibly damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Actl6b A G 5: 137,555,065 N113S probably benign Het
Actn3 A T 19: 4,871,615 V179E probably damaging Het
Aff4 C A 11: 53,415,466 T1145N probably damaging Het
Ankrd42 G A 7: 92,591,859 Q431* probably null Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Asap3 C A 4: 136,234,604 N285K probably damaging Het
Atp6v0a2 A G 5: 124,713,184 N477S probably damaging Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
C87436 G A 6: 86,469,827 G533D probably damaging Het
Ccdc138 T A 10: 58,528,360 I314N probably damaging Het
Ccs A G 19: 4,825,626 F237S probably damaging Het
Ccz1 T G 5: 144,009,294 probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Chd1 A G 17: 17,393,567 N531S probably damaging Het
Clptm1 A T 7: 19,635,007 F476I probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dlg1 G T 16: 31,858,065 probably null Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Ergic3 C A 2: 156,011,140 R43S possibly damaging Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Ghrl A T 6: 113,717,168 probably benign Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm12166 A G 11: 46,052,293 M1T probably null Het
Gm4787 T A 12: 81,377,747 K546* probably null Het
Gm498 G T 7: 143,891,755 G178C probably damaging Het
Gm6576 C G 15: 27,026,000 noncoding transcript Het
Got1 C T 19: 43,524,377 D27N probably benign Het
Gucy2c C T 6: 136,704,249 V946I probably damaging Het
Hectd4 T C 5: 121,349,243 Y3434H possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Itpr1 A G 6: 108,471,209 probably benign Het
Kctd1 G A 18: 14,974,180 P743S probably benign Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Krt24 T C 11: 99,280,267 D495G probably damaging Het
L3hypdh C T 12: 72,077,143 probably null Het
Lipo3 C T 19: 33,557,106 probably null Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k4 T A 17: 12,248,063 D1104V probably damaging Het
Mpeg1 T C 19: 12,461,223 V15A probably benign Het
Narf C T 11: 121,250,836 R356C probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Olfm5 G A 7: 104,160,926 A76V probably benign Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr656 A T 7: 104,618,581 I301F probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Palb2 A T 7: 122,128,166 Y160* probably null Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pdcd11 G A 19: 47,119,862 V1223I probably benign Het
Pde6c T C 19: 38,169,365 probably benign Het
Prr12 A G 7: 45,050,039 probably benign Het
Prss39 T A 1: 34,502,200 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sfr1 A G 19: 47,735,018 *320W probably null Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Slc1a3 T C 15: 8,636,209 M519V probably benign Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Spag9 T A 11: 94,093,539 I327N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Unc79 A G 12: 103,088,434 probably benign Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Wrap73 A G 4: 154,142,500 D19G possibly damaging Het
Other mutations in Ubap2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2l APN 3 90009256 nonsense probably null
IGL02606:Ubap2l APN 3 90038428 missense probably damaging 0.98
IGL02809:Ubap2l APN 3 90021246 missense probably damaging 1.00
Panhandle UTSW 3 90031376 splice site probably benign
plainview UTSW 3 90038850 missense probably damaging 1.00
R0052:Ubap2l UTSW 3 90038928 missense possibly damaging 0.93
R0052:Ubap2l UTSW 3 90038928 missense possibly damaging 0.93
R0130:Ubap2l UTSW 3 90021373 missense possibly damaging 0.89
R0502:Ubap2l UTSW 3 90009213 missense probably damaging 1.00
R0619:Ubap2l UTSW 3 90017220 missense probably benign 0.01
R0726:Ubap2l UTSW 3 90021246 missense probably damaging 1.00
R1023:Ubap2l UTSW 3 90047873 utr 5 prime probably benign
R1172:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1174:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1175:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1191:Ubap2l UTSW 3 90023575 missense probably damaging 1.00
R1432:Ubap2l UTSW 3 90019328 missense probably benign 0.11
R1582:Ubap2l UTSW 3 90034671 missense probably damaging 1.00
R1771:Ubap2l UTSW 3 90019231 missense probably damaging 1.00
R2058:Ubap2l UTSW 3 90031376 splice site probably benign
R2059:Ubap2l UTSW 3 90031376 splice site probably benign
R2081:Ubap2l UTSW 3 90038964 missense possibly damaging 0.92
R2408:Ubap2l UTSW 3 90009132 missense probably null 0.99
R3404:Ubap2l UTSW 3 90038850 missense probably damaging 1.00
R3551:Ubap2l UTSW 3 90015451 missense unknown
R4132:Ubap2l UTSW 3 90009184 missense probably damaging 1.00
R4782:Ubap2l UTSW 3 90020903 missense probably damaging 0.98
R4798:Ubap2l UTSW 3 90020903 missense probably damaging 0.98
R5173:Ubap2l UTSW 3 90021030 missense possibly damaging 0.86
R5274:Ubap2l UTSW 3 90012730 missense probably damaging 1.00
R5387:Ubap2l UTSW 3 90006596 missense probably benign 0.10
R6548:Ubap2l UTSW 3 90023560 missense probably damaging 1.00
R6912:Ubap2l UTSW 3 90038848 missense possibly damaging 0.84
R6995:Ubap2l UTSW 3 90009241 missense probably damaging 0.98
R7039:Ubap2l UTSW 3 90002355 missense probably damaging 1.00
R7323:Ubap2l UTSW 3 90015406 missense unknown
R7512:Ubap2l UTSW 3 90010496 missense unknown
Predicted Primers PCR Primer
(F):5'- CCACAGCCAGAGCAGGAATCTATG -3'
(R):5'- TGGCAAGAATCTTTATGCACTGAGAGC -3'

Sequencing Primer
(F):5'- ATAAACCCTTAGACTATCTCATCCTG -3'
(R):5'- ATGCACTGAGAGCCATTTTGC -3'
Posted On2013-07-24