Incidental Mutation 'RF045:Cyp4a12b'
ID604992
Institutional Source Beutler Lab
Gene Symbol Cyp4a12b
Ensembl Gene ENSMUSG00000078597
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 12B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #RF045 (G1)
Quality Score127.008
Status Not validated
Chromosome4
Chromosomal Location115411624-115439034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115432493 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 186 (H186Y)
Ref Sequence ENSEMBL: ENSMUSP00000092487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094887]
Predicted Effect probably benign
Transcript: ENSMUST00000094887
AA Change: H186Y

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092487
Gene: ENSMUSG00000078597
AA Change: H186Y

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:p450 51 503 1.9e-132 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik TTCTGTA T 1: 43,737,192 probably benign Het
AI837181 GCG GCGCCG 19: 5,425,218 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Cdsn CAGC CAGCAGCTCTCAGTCAGGAAGTAGC 17: 35,554,968 probably benign Het
Cyb5r4 ATGT ATGTGAGACACACTGCCCAGGGATGTGT 9: 87,040,402 probably null Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGAA 9: 87,040,447 probably benign Het
Dbr1 AAGAGGA AAGAGGAAGAGGA 9: 99,583,671 probably benign Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGCGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Dnmt1 TACCTCGTT TACCTCGTTTTGGGGGCGGAGCACAGTTCCCACCTCGTT 9: 20,910,137 probably benign Het
Fam71e1 GGAGGA GGAGGAAGGCTGGATCCTGGATACCTGGGTCTGAGTGAGGA 7: 44,500,532 probably null Het
Gabre CTCAGGCT C X: 72,270,181 probably null Het
Gabre CCGGCT CCGGCTGCGGCT X: 72,270,045 probably benign Het
Iqcf4 TTCCTTTTCCTTTT TTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTATCCTTTTCCTTTT 9: 106,570,610 probably benign Het
Kcnq3 CCGCCAGCCGC CC 15: 66,286,184 probably benign Het
Krtap28-10 CCACAG CCACAGTCACAG 1: 83,042,143 probably benign Het
Krtap28-10 CACAGCCACCACAGCCACAGCCACCACAGC CACAGCCACCACAGCAACAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,261 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,292 probably benign Het
Map1a CAGCTCCAGCTCCAGCTCC CAGCTCCAGCTCCAGCTCCCGCTCCAGCTCTAGCTCCAGCTCCAGCTCC 2: 121,306,293 probably benign Het
Ncapd2 ACT ACTACACGCCGTCAGAGCACCGTGTTCTGTCACATCCT 6: 125,179,236 probably null Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Ntn4 G T 10: 93,710,625 R380L possibly damaging Het
Nusap1 A ATACACGTTAGCAGTGAGGAGCAAGCTGAGG 2: 119,627,610 probably benign Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Ptms CTCCTC CTCCTCCTC 6: 124,914,450 probably benign Het
Snx1 CTGTT CTGTTGTT 9: 66,104,922 probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACACCAGTC 17: 78,677,282 probably null Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,727,666 probably benign Het
Other mutations in Cyp4a12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cyp4a12b APN 4 115438049 splice site probably null
IGL01571:Cyp4a12b APN 4 115438157 missense probably benign 0.00
IGL02230:Cyp4a12b APN 4 115433996 missense probably damaging 1.00
IGL02720:Cyp4a12b APN 4 115435171 splice site probably benign
IGL03118:Cyp4a12b APN 4 115432976 missense possibly damaging 0.54
IGL03389:Cyp4a12b APN 4 115433808 missense possibly damaging 0.90
R0360:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0364:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0844:Cyp4a12b UTSW 4 115432524 missense possibly damaging 0.67
R1226:Cyp4a12b UTSW 4 115432967 missense possibly damaging 0.80
R1232:Cyp4a12b UTSW 4 115432563 missense possibly damaging 0.81
R1372:Cyp4a12b UTSW 4 115432949 missense probably benign 0.08
R1559:Cyp4a12b UTSW 4 115433984 missense probably damaging 0.98
R1782:Cyp4a12b UTSW 4 115433981 missense probably damaging 1.00
R1817:Cyp4a12b UTSW 4 115414062 splice site probably benign
R1941:Cyp4a12b UTSW 4 115438059 missense probably damaging 1.00
R1978:Cyp4a12b UTSW 4 115438145 missense probably benign 0.01
R2063:Cyp4a12b UTSW 4 115433503 missense possibly damaging 0.87
R2109:Cyp4a12b UTSW 4 115432913 missense probably damaging 0.97
R2911:Cyp4a12b UTSW 4 115433526 nonsense probably null
R3791:Cyp4a12b UTSW 4 115434970 missense probably benign 0.01
R3815:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3816:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3817:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3818:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R4586:Cyp4a12b UTSW 4 115432506 missense probably damaging 1.00
R5004:Cyp4a12b UTSW 4 115438113 missense probably benign 0.39
R5105:Cyp4a12b UTSW 4 115433761 missense probably damaging 1.00
R5354:Cyp4a12b UTSW 4 115433464 splice site probably null
R5655:Cyp4a12b UTSW 4 115433797 missense probably damaging 1.00
R5814:Cyp4a12b UTSW 4 115432497 missense probably damaging 0.97
R5952:Cyp4a12b UTSW 4 115414517 nonsense probably null
R6004:Cyp4a12b UTSW 4 115433467 missense probably benign 0.35
R6059:Cyp4a12b UTSW 4 115438104 missense possibly damaging 0.94
R6261:Cyp4a12b UTSW 4 115414543 nonsense probably null
R7484:Cyp4a12b UTSW 4 115432563 missense possibly damaging 0.81
R7734:Cyp4a12b UTSW 4 115411740 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCTTCACAACATCTGATACAGGGAG -3'
(R):5'- ATTCAGGCTTCCATCTATCTGG -3'

Sequencing Primer
(F):5'- CATCTGATACAGGGAGTCATAAAATC -3'
(R):5'- TCCATCTATCTGGAAATCTGCAG -3'
Posted On2019-12-04