Incidental Mutation 'RF045:Ntn4'
ID 605003
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Name netrin 4
Synonyms beta-netrin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF045 (G1)
Quality Score 196.009
Status Not validated
Chromosome 10
Chromosomal Location 93640681-93747207 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 93710625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 380 (R380L)
Ref Sequence ENSEMBL: ENSMUSP00000020204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204]
AlphaFold Q9JI33
Predicted Effect possibly damaging
Transcript: ENSMUST00000020204
AA Change: R380L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: R380L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik TTCTGTA T 1: 43,737,192 probably benign Het
AI837181 GCG GCGCCG 19: 5,425,218 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Cdsn CAGC CAGCAGCTCTCAGTCAGGAAGTAGC 17: 35,554,968 probably benign Het
Cyb5r4 ATGT ATGTGAGACACACTGCCCAGGGATGTGT 9: 87,040,402 probably null Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGAA 9: 87,040,447 probably benign Het
Cyp4a12b C T 4: 115,432,493 H186Y probably benign Het
Dbr1 AAGAGGA AAGAGGAAGAGGA 9: 99,583,671 probably benign Het
Dnmt1 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGCGCGGAGCCCAGTTCCTACCTCGTT 9: 20,910,129 probably null Het
Dnmt1 TACCTCGTT TACCTCGTTTTGGGGGCGGAGCACAGTTCCCACCTCGTT 9: 20,910,137 probably benign Het
Fam71e1 GGAGGA GGAGGAAGGCTGGATCCTGGATACCTGGGTCTGAGTGAGGA 7: 44,500,532 probably null Het
Gabre CCGGCT CCGGCTGCGGCT X: 72,270,045 probably benign Het
Gabre CTCAGGCT C X: 72,270,181 probably null Het
Iqcf4 TTCCTTTTCCTTTT TTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTATCCTTTTCCTTTT 9: 106,570,610 probably benign Het
Kcnq3 CCGCCAGCCGC CC 15: 66,286,184 probably benign Het
Krtap28-10 CCACAG CCACAGTCACAG 1: 83,042,143 probably benign Het
Krtap28-10 CACAGCCACCACAGCCACAGCCACCACAGC CACAGCCACCACAGCAACAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,261 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,292 probably benign Het
Map1a CAGCTCCAGCTCCAGCTCC CAGCTCCAGCTCCAGCTCCCGCTCCAGCTCTAGCTCCAGCTCCAGCTCC 2: 121,306,293 probably benign Het
Ncapd2 ACT ACTACACGCCGTCAGAGCACCGTGTTCTGTCACATCCT 6: 125,179,236 probably null Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nusap1 A ATACACGTTAGCAGTGAGGAGCAAGCTGAGG 2: 119,627,610 probably benign Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Ptms CTCCTC CTCCTCCTC 6: 124,914,450 probably benign Het
Snx1 CTGTT CTGTTGTT 9: 66,104,922 probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACACCAGTC 17: 78,677,282 probably null Het
Supt20 GCAGCA GCAGCATCAGCA 3: 54,727,666 probably benign Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93707349 missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93644849 missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93644659 missense probably benign 0.19
IGL02752:Ntn4 APN 10 93710559 missense possibly damaging 0.84
PIT4468001:Ntn4 UTSW 10 93644725 missense probably damaging 0.99
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0132:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0419:Ntn4 UTSW 10 93682429 missense probably benign 0.04
R1304:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93644734 missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93733602 splice site probably null
R1796:Ntn4 UTSW 10 93745771 missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93644839 missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2975:Ntn4 UTSW 10 93644891 missense probably damaging 1.00
R4277:Ntn4 UTSW 10 93741210 missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4806:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93644764 missense probably benign 0.40
R6048:Ntn4 UTSW 10 93707266 splice site probably null
R6051:Ntn4 UTSW 10 93745795 missense probably benign
R6346:Ntn4 UTSW 10 93644861 missense probably damaging 1.00
R6752:Ntn4 UTSW 10 93734175 missense probably benign
R7196:Ntn4 UTSW 10 93733714 missense probably benign 0.01
R7240:Ntn4 UTSW 10 93745741 missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93644804 missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93682572 missense probably benign
R7505:Ntn4 UTSW 10 93707284 missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93710568 missense probably benign 0.01
R7726:Ntn4 UTSW 10 93733682 missense possibly damaging 0.82
R7957:Ntn4 UTSW 10 93644473 splice site probably benign
R8092:Ntn4 UTSW 10 93741056 missense probably damaging 0.97
R8202:Ntn4 UTSW 10 93644903 missense possibly damaging 0.88
R8508:Ntn4 UTSW 10 93741104 missense possibly damaging 0.48
R9010:Ntn4 UTSW 10 93644644 missense
R9115:Ntn4 UTSW 10 93733813 missense probably benign
R9415:Ntn4 UTSW 10 93644626 missense probably benign 0.00
X0024:Ntn4 UTSW 10 93644971 missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93741153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTCTGACGTCTTGACCGTTG -3'
(R):5'- TGTGAACACTGGGCTATTTTGAC -3'

Sequencing Primer
(F):5'- ACGTCTTGACCGTTGGAGAAC -3'
(R):5'- CACTGGGCTATTTTGACTGAACAG -3'
Posted On 2019-12-04