Incidental Mutation 'RF046:Lce1m'
ID 605017
Institutional Source Beutler Lab
Gene Symbol Lce1m
Ensembl Gene ENSMUSG00000027912
Gene Name late cornified envelope 1M
Synonyms Sprrl10, Lce5a, 1110059L13Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock # RF046 (G1)
Quality Score 124.467
Status Not validated
Chromosome 3
Chromosomal Location 93017810-93019060 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) GCT to GCTCCCACCCCTTCT at 93018293 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
AlphaFold Q9CR91
Predicted Effect probably benign
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

DomainStartEndE-ValueType
Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029521
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
low complexity region 12 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107301
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CATC CATCATC 2: 130,770,734 probably null Het
4930505A04Rik TTTT TTTTT 11: 30,426,249 probably null Het
Ankhd1 CGGCGG CGGCGGGGGCGG 18: 36,560,926 probably benign Het
Apc A AATAAAGCGC 18: 34,282,009 probably benign Het
Arid1b GGC GGCCGC 17: 4,995,590 probably benign Het
Chd4 G GTTCCCT 6: 125,122,131 probably benign Het
Dclre1a CTTTGCT C 19: 56,544,132 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Fkbp1a CGCCGCCGCCA C 2: 151,542,698 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAATCCTGGTGT 17: 23,762,169 probably null Het
Flywch1 GGTGT GGTGTGGGGAGGCTACGTACTCACCCACTCCTTGTGT 17: 23,762,174 probably null Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Iqcf4 TTCCTTTTCCTTTT TTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTGTCCTTTTCCTTTT 9: 106,570,610 probably benign Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Nusap1 GAGGAGCAAGCTGAGA GAGGAGCAAGCTGAGATACACGTTAGCAGTTAGGAGCAAGCTGAGA 2: 119,627,595 probably null Het
Pkhd1l1 TTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTT 15: 44,558,495 probably benign Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Pnmal1 TA TAACTCATGATGCTCCTGCTTCAACA 7: 16,961,423 probably benign Het
Rfx4 CTCTCTCTCTCTCT CTCTCTCTCTCTCTCTATCTCTCTCTCTCT 10: 84,858,481 probably benign Het
Rtbdn C CAGCGGG 8: 84,956,179 probably benign Het
Thegl CGATCCTCCCCAGTCCCGCAAGGCCAG CGATCCTCCCCAGTCCCGCAAGGCCAGGGATCCTCCCCAGTCCCGCAAGGCCAG 5: 77,016,403 probably benign Het
Trp53bp1 TCCTGTGAGGCCCTCTGCTGC TC 2: 121,216,001 probably null Het
Tusc1 CCGCCA CCGCCAACGCCA 4: 93,335,302 probably benign Het
Usp2 TGACCTGTTCTTCACTTAC TGACCTGTTCTTCACTTACTCATGCGACCTGTTCTTCACTTAC 9: 44,089,111 probably benign Het
Znrd1as CACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCAC 17: 36,965,057 probably benign Het
Other mutations in Lce1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Lce1m UTSW 3 93018247 unclassified probably benign
FR4449:Lce1m UTSW 3 93018152 unclassified probably benign
FR4589:Lce1m UTSW 3 93018268 unclassified probably benign
FR4976:Lce1m UTSW 3 93018148 unclassified probably benign
R1513:Lce1m UTSW 3 93018625 unclassified probably benign
R7621:Lce1m UTSW 3 93017870 splice site probably null
R7753:Lce1m UTSW 3 93018508 missense unknown
RF001:Lce1m UTSW 3 93018152 unclassified probably benign
RF001:Lce1m UTSW 3 93018269 unclassified probably benign
RF002:Lce1m UTSW 3 93018283 unclassified probably benign
RF002:Lce1m UTSW 3 93018299 unclassified probably benign
RF007:Lce1m UTSW 3 93018144 unclassified probably benign
RF009:Lce1m UTSW 3 93018131 unclassified probably benign
RF010:Lce1m UTSW 3 93018290 unclassified probably benign
RF015:Lce1m UTSW 3 93018148 unclassified probably benign
RF021:Lce1m UTSW 3 93018269 unclassified probably benign
RF021:Lce1m UTSW 3 93018295 unclassified probably benign
RF023:Lce1m UTSW 3 93018280 unclassified probably benign
RF026:Lce1m UTSW 3 93018138 unclassified probably benign
RF026:Lce1m UTSW 3 93018143 unclassified probably benign
RF028:Lce1m UTSW 3 93018131 unclassified probably benign
RF030:Lce1m UTSW 3 93018141 unclassified probably benign
RF030:Lce1m UTSW 3 93018344 unclassified probably benign
RF037:Lce1m UTSW 3 93018300 unclassified probably benign
RF041:Lce1m UTSW 3 93018141 unclassified probably benign
RF042:Lce1m UTSW 3 93018139 unclassified probably benign
RF045:Lce1m UTSW 3 93018292 unclassified probably benign
RF054:Lce1m UTSW 3 93018298 unclassified probably benign
RF059:Lce1m UTSW 3 93018329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGTTCTTCGTGGCCAGGTC -3'
(R):5'- TGGAGATGTCCTGTCAGCAG -3'

Sequencing Primer
(F):5'- GGTCAGCAGCAACCTCCAGAG -3'
(R):5'- ATGTCCTGTCAGCAGAGCCAG -3'
Posted On 2019-12-04