Incidental Mutation 'RF046:Tusc1'
ID605018
Institutional Source Beutler Lab
Gene Symbol Tusc1
Ensembl Gene ENSMUSG00000054000
Gene Nametumor suppressor candidate 1
Synonyms2200001D17Rik, TSG-9
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF046 (G1)
Quality Score126.588
Status Not validated
Chromosome4
Chromosomal Location93334138-93335511 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) CCGCCA to CCGCCAACGCCA at 93335302 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066774]
Predicted Effect probably benign
Transcript: ENSMUST00000066774
SMART Domains Protein: ENSMUSP00000069652
Gene: ENSMUSG00000054000

DomainStartEndE-ValueType
low complexity region 5 52 N/A INTRINSIC
coiled coil region 66 110 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the region of chromosome 9p that harbors tumor suppressor genes critical in carcinogenesis. It is an intronless gene which is downregulated in non-small-cell lung cancer and small-cell lung cancer cell lines, suggesting that it may play a role in lung tumorigenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CATC CATCATC 2: 130,770,734 probably null Het
4930505A04Rik TTTT TTTTT 11: 30,426,249 probably null Het
Ankhd1 CGGCGG CGGCGGGGGCGG 18: 36,560,926 probably benign Het
Apc A AATAAAGCGC 18: 34,282,009 probably benign Het
Arid1b GGC GGCCGC 17: 4,995,590 probably benign Het
Chd4 G GTTCCCT 6: 125,122,131 probably benign Het
Dclre1a CTTTGCT C 19: 56,544,132 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Fkbp1a CGCCGCCGCCA C 2: 151,542,698 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAATCCTGGTGT 17: 23,762,169 probably null Het
Flywch1 GGTGT GGTGTGGGGAGGCTACGTACTCACCCACTCCTTGTGT 17: 23,762,174 probably null Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Iqcf4 TTCCTTTTCCTTTT TTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTGTCCTTTTCCTTTT 9: 106,570,610 probably benign Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Lce1m GCT GCTCCCACCCCTTCT 3: 93,018,293 probably benign Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Nusap1 GAGGAGCAAGCTGAGA GAGGAGCAAGCTGAGATACACGTTAGCAGTTAGGAGCAAGCTGAGA 2: 119,627,595 probably null Het
Pkhd1l1 TTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTT 15: 44,558,495 probably benign Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Pnmal1 TA TAACTCATGATGCTCCTGCTTCAACA 7: 16,961,423 probably benign Het
Rfx4 CTCTCTCTCTCTCT CTCTCTCTCTCTCTCTATCTCTCTCTCTCT 10: 84,858,481 probably benign Het
Rtbdn C CAGCGGG 8: 84,956,179 probably benign Het
Thegl CGATCCTCCCCAGTCCCGCAAGGCCAG CGATCCTCCCCAGTCCCGCAAGGCCAGGGATCCTCCCCAGTCCCGCAAGGCCAG 5: 77,016,403 probably benign Het
Trp53bp1 TCCTGTGAGGCCCTCTGCTGC TC 2: 121,216,001 probably null Het
Usp2 TGACCTGTTCTTCACTTAC TGACCTGTTCTTCACTTACTCATGCGACCTGTTCTTCACTTAC 9: 44,089,111 probably benign Het
Znrd1as CACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCAC 17: 36,965,057 probably benign Het
Other mutations in Tusc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:Tusc1 UTSW 4 93335303 small insertion probably benign
FR4589:Tusc1 UTSW 4 93335307 small insertion probably benign
FR4737:Tusc1 UTSW 4 93335313 small insertion probably benign
R0131:Tusc1 UTSW 4 93334833 missense probably benign 0.00
R2212:Tusc1 UTSW 4 93334936 missense probably damaging 0.99
R3412:Tusc1 UTSW 4 93334936 missense probably damaging 0.99
R3413:Tusc1 UTSW 4 93334936 missense probably damaging 0.99
R3414:Tusc1 UTSW 4 93334936 missense probably damaging 0.99
RF021:Tusc1 UTSW 4 93335316 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACATGACCTCCAGCTTCTCTAG -3'
(R):5'- AGCAGAGGACAAGGCTTTC -3'

Sequencing Primer
(F):5'- AAGAGGCTGCGGTTCTCG -3'
(R):5'- ACAAGGCTTTCCGGGCAC -3'
Posted On2019-12-04