Incidental Mutation 'RF046:H2-T10'
ID605035
Institutional Source Beutler Lab
Gene Symbol H2-T10
Ensembl Gene ENSMUSG00000079491
Gene Namehistocompatibility 2, T region locus 10
SynonymsH-2T10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #RF046 (G1)
Quality Score214.458
Status Not validated
Chromosome17
Chromosomal Location36115876-36121465 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TTTCCCACTGTA to T at 36120294 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046131] [ENSMUST00000166442] [ENSMUST00000173128] [ENSMUST00000174382]
Predicted Effect probably benign
Transcript: ENSMUST00000046131
SMART Domains Protein: ENSMUSP00000040558
Gene: ENSMUSG00000092243

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 2.3e-81 PFAM
IGc1 220 285 8.12e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166442
SMART Domains Protein: ENSMUSP00000127602
Gene: ENSMUSG00000079491

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 191 6.2e-49 PFAM
IGc1 210 281 4.18e-24 SMART
transmembrane domain 294 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173128
SMART Domains Protein: ENSMUSP00000134339
Gene: ENSMUSG00000092277

DomainStartEndE-ValueType
low complexity region 103 115 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174382
SMART Domains Protein: ENSMUSP00000133893
Gene: ENSMUSG00000079491

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 205 9.5e-47 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CATC CATCATC 2: 130,770,734 probably null Het
4930505A04Rik TTTT TTTTT 11: 30,426,249 probably null Het
Ankhd1 CGGCGG CGGCGGGGGCGG 18: 36,560,926 probably benign Het
Apc A AATAAAGCGC 18: 34,282,009 probably benign Het
Arid1b GGC GGCCGC 17: 4,995,590 probably benign Het
Chd4 G GTTCCCT 6: 125,122,131 probably benign Het
Dclre1a CTTTGCT C 19: 56,544,132 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Fkbp1a CGCCGCCGCCA C 2: 151,542,698 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAATCCTGGTGT 17: 23,762,169 probably null Het
Flywch1 GGTGT GGTGTGGGGAGGCTACGTACTCACCCACTCCTTGTGT 17: 23,762,174 probably null Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Iqcf4 TTCCTTTTCCTTTT TTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTGTCCTTTTCCTTTT 9: 106,570,610 probably benign Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Lce1m GCT GCTCCCACCCCTTCT 3: 93,018,293 probably benign Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Nusap1 GAGGAGCAAGCTGAGA GAGGAGCAAGCTGAGATACACGTTAGCAGTTAGGAGCAAGCTGAGA 2: 119,627,595 probably null Het
Pkhd1l1 TTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTT 15: 44,558,495 probably benign Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Pnmal1 TA TAACTCATGATGCTCCTGCTTCAACA 7: 16,961,423 probably benign Het
Rfx4 CTCTCTCTCTCTCT CTCTCTCTCTCTCTCTATCTCTCTCTCTCT 10: 84,858,481 probably benign Het
Rtbdn C CAGCGGG 8: 84,956,179 probably benign Het
Thegl CGATCCTCCCCAGTCCCGCAAGGCCAG CGATCCTCCCCAGTCCCGCAAGGCCAGGGATCCTCCCCAGTCCCGCAAGGCCAG 5: 77,016,403 probably benign Het
Trp53bp1 TCCTGTGAGGCCCTCTGCTGC TC 2: 121,216,001 probably null Het
Tusc1 CCGCCA CCGCCAACGCCA 4: 93,335,302 probably benign Het
Usp2 TGACCTGTTCTTCACTTAC TGACCTGTTCTTCACTTACTCATGCGACCTGTTCTTCACTTAC 9: 44,089,111 probably benign Het
Znrd1as CACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCAC 17: 36,965,057 probably benign Het
Other mutations in H2-T10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:H2-T10 APN 17 36120710 missense probably benign 0.08
IGL01946:H2-T10 APN 17 36120716 missense possibly damaging 0.45
IGL03367:H2-T10 APN 17 36120393 missense possibly damaging 0.81
IGL03381:H2-T10 APN 17 36119354 missense probably benign
IGL03381:H2-T10 APN 17 36119357 nonsense probably null
FR4304:H2-T10 UTSW 17 36120281 frame shift probably null
R0305:H2-T10 UTSW 17 36119368 missense probably damaging 1.00
R1446:H2-T10 UTSW 17 36119374 missense possibly damaging 0.87
R1483:H2-T10 UTSW 17 36121146 missense probably benign 0.44
R2038:H2-T10 UTSW 17 36119425 missense probably benign 0.00
R2402:H2-T10 UTSW 17 36117739 splice site probably null
R4755:H2-T10 UTSW 17 36118945 nonsense probably null
R4957:H2-T10 UTSW 17 36117416 utr 3 prime probably benign
R5162:H2-T10 UTSW 17 36118951 unclassified probably null
R5568:H2-T10 UTSW 17 36119187 critical splice donor site probably null
R6226:H2-T10 UTSW 17 36121083 missense probably damaging 0.99
R6850:H2-T10 UTSW 17 36119260 missense probably damaging 1.00
R7249:H2-T10 UTSW 17 36119377 missense probably damaging 0.99
R7324:H2-T10 UTSW 17 36119297 missense probably damaging 1.00
R7466:H2-T10 UTSW 17 36120849 missense probably benign 0.10
R7679:H2-T10 UTSW 17 36119324 missense not run
R7767:H2-T10 UTSW 17 36117730 missense probably benign 0.02
R7901:H2-T10 UTSW 17 36120251 missense probably benign
R7984:H2-T10 UTSW 17 36120251 missense probably benign
RF032:H2-T10 UTSW 17 36120294 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGAGCCTCTTGCCTCTCTG -3'
(R):5'- GGACTGACCACCAACTATGTC -3'

Sequencing Primer
(F):5'- GGATCTAAACCAGAACTCGTGCTTG -3'
(R):5'- GACCACCAACTATGTCCTTCCTAG -3'
Posted On2019-12-04