Incidental Mutation 'RF046:Znrd1as'
ID605036
Institutional Source Beutler Lab
Gene Symbol Znrd1as
Ensembl Gene ENSMUSG00000036214
Gene Namezinc ribbon domain containing 1, antisense
Synonyms1700022C21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #RF046 (G1)
Quality Score217.468
Status Not validated
Chromosome17
Chromosomal Location36958592-36965625 bp(+) (GRCm38)
Type of Mutationsmall insertion (7 aa in frame mutation)
DNA Base Change (assembly) CACCACCACCACCAC to CACCACCACCACCACCACCACAACCACCACCACCAC at 36965057 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040177] [ENSMUST00000173814] [ENSMUST00000209623]
Predicted Effect probably benign
Transcript: ENSMUST00000040177
SMART Domains Protein: ENSMUSP00000048695
Gene: ENSMUSG00000036214

DomainStartEndE-ValueType
low complexity region 98 115 N/A INTRINSIC
coiled coil region 163 195 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173814
SMART Domains Protein: ENSMUSP00000134016
Gene: ENSMUSG00000036214

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
coiled coil region 84 116 N/A INTRINSIC
low complexity region 145 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209623
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CATC CATCATC 2: 130,770,734 probably null Het
4930505A04Rik TTTT TTTTT 11: 30,426,249 probably null Het
Ankhd1 CGGCGG CGGCGGGGGCGG 18: 36,560,926 probably benign Het
Apc A AATAAAGCGC 18: 34,282,009 probably benign Het
Arid1b GGC GGCCGC 17: 4,995,590 probably benign Het
Chd4 G GTTCCCT 6: 125,122,131 probably benign Het
Dclre1a CTTTGCT C 19: 56,544,132 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Fkbp1a CGCCGCCGCCA C 2: 151,542,698 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAATCCTGGTGT 17: 23,762,169 probably null Het
Flywch1 GGTGT GGTGTGGGGAGGCTACGTACTCACCCACTCCTTGTGT 17: 23,762,174 probably null Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Iqcf4 TTCCTTTTCCTTTT TTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTGTCCTTTTCCTTTT 9: 106,570,610 probably benign Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Lce1m GCT GCTCCCACCCCTTCT 3: 93,018,293 probably benign Het
Lcmt1 GGC GGCCGCGGGGCGC 7: 123,369,834 probably null Het
Nusap1 GAGGAGCAAGCTGAGA GAGGAGCAAGCTGAGATACACGTTAGCAGTTAGGAGCAAGCTGAGA 2: 119,627,595 probably null Het
Pkhd1l1 TTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTT 15: 44,558,495 probably benign Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Pnmal1 TA TAACTCATGATGCTCCTGCTTCAACA 7: 16,961,423 probably benign Het
Rfx4 CTCTCTCTCTCTCT CTCTCTCTCTCTCTCTATCTCTCTCTCTCT 10: 84,858,481 probably benign Het
Rtbdn C CAGCGGG 8: 84,956,179 probably benign Het
Thegl CGATCCTCCCCAGTCCCGCAAGGCCAG CGATCCTCCCCAGTCCCGCAAGGCCAGGGATCCTCCCCAGTCCCGCAAGGCCAG 5: 77,016,403 probably benign Het
Trp53bp1 TCCTGTGAGGCCCTCTGCTGC TC 2: 121,216,001 probably null Het
Tusc1 CCGCCA CCGCCAACGCCA 4: 93,335,302 probably benign Het
Usp2 TGACCTGTTCTTCACTTAC TGACCTGTTCTTCACTTACTCATGCGACCTGTTCTTCACTTAC 9: 44,089,111 probably benign Het
Other mutations in Znrd1as
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Znrd1as APN 17 36964921 missense probably damaging 0.99
R0347:Znrd1as UTSW 17 36965315 missense probably damaging 1.00
R0789:Znrd1as UTSW 17 36964960 missense probably damaging 1.00
R0993:Znrd1as UTSW 17 36965047 small deletion probably benign
R2110:Znrd1as UTSW 17 36965444 missense possibly damaging 0.47
R2866:Znrd1as UTSW 17 36965160 missense possibly damaging 0.91
R4224:Znrd1as UTSW 17 36958725 utr 5 prime probably benign
R4746:Znrd1as UTSW 17 36964873 missense probably benign 0.00
R7449:Znrd1as UTSW 17 36964383 missense probably damaging 1.00
RF005:Znrd1as UTSW 17 36965048 small insertion probably benign
RF008:Znrd1as UTSW 17 36965054 small insertion probably benign
RF010:Znrd1as UTSW 17 36965063 small insertion probably benign
RF014:Znrd1as UTSW 17 36965060 small insertion probably benign
RF024:Znrd1as UTSW 17 36965057 small insertion probably benign
RF025:Znrd1as UTSW 17 36965048 small insertion probably benign
RF029:Znrd1as UTSW 17 36965071 small insertion probably benign
RF035:Znrd1as UTSW 17 36965066 small insertion probably benign
RF048:Znrd1as UTSW 17 36965059 small insertion probably benign
RF053:Znrd1as UTSW 17 36965066 small insertion probably benign
RF064:Znrd1as UTSW 17 36965050 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCATACAACAGCAGCAAG -3'
(R):5'- GTGGGATGCTTTCCTCCTCTAG -3'

Sequencing Primer
(F):5'- CTTGATAACTCAGAAATGCCATGAGG -3'
(R):5'- TCCTCTAGCACAATTTTGGGTAG -3'
Posted On2019-12-04