Incidental Mutation 'RF047:Rbm33'
ID605045
Institutional Source Beutler Lab
Gene Symbol Rbm33
Ensembl Gene ENSMUSG00000048271
Gene NameRNA binding motif protein 33
Synonyms6430512A10Rik, 3200001K10Rik, Prr8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF047 (G1)
Quality Score214.458
Status Not validated
Chromosome5
Chromosomal Location28317121-28419239 bp(+) (GRCm38)
Type of Mutationsmall insertion (4 aa in frame mutation)
DNA Base Change (assembly) AGCAGCA to AGCAGCACCAGCCGCAGCA at 28394162 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000059644] [ENSMUST00000114884]
Predicted Effect probably benign
Transcript: ENSMUST00000059644
SMART Domains Protein: ENSMUSP00000062449
Gene: ENSMUSG00000048271

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 307 327 N/A INTRINSIC
low complexity region 362 407 N/A INTRINSIC
low complexity region 444 460 N/A INTRINSIC
low complexity region 625 707 N/A INTRINSIC
low complexity region 817 837 N/A INTRINSIC
coiled coil region 846 891 N/A INTRINSIC
RRM 1160 1227 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114884
SMART Domains Protein: ENSMUSP00000110534
Gene: ENSMUSG00000048271

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 267 287 N/A INTRINSIC
low complexity region 322 367 N/A INTRINSIC
low complexity region 404 420 N/A INTRINSIC
low complexity region 585 667 N/A INTRINSIC
low complexity region 777 797 N/A INTRINSIC
coiled coil region 806 851 N/A INTRINSIC
RRM 1120 1187 4.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144967
SMART Domains Protein: ENSMUSP00000121879
Gene: ENSMUSG00000048271

DomainStartEndE-ValueType
RRM 119 186 1.12e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 AAGA AA 5: 8,896,595 probably null Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,917 probably benign Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,923 probably benign Het
Cd109 TTATTTAT TTATTTATTTCTGTATTTAT 9: 78,712,527 probably benign Het
Dnah11 C A 12: 118,010,083 G2832V probably damaging Het
Dnmt1 GAGCACAGTTCCTACCTCGTT GAGCACAGTTCCTACCTCGTTTTGGGGGCGTAGCACAGTTCCTACCTCGTT 9: 20,910,125 probably null Het
Fam71e1 GAGGGAGGA GAGGGAGGAAGGCTGGATCCTGGATACCTGGGTCTTAGGGAGGA 7: 44,500,529 probably null Het
Fam71e1 G GCAGGGTGGATCCTGGATACCTGGGTCTGCGGGAGT 7: 44,500,536 probably null Het
Gab3 TCT TCTGCT X: 74,999,993 probably benign Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,053 probably benign Het
Gabre C CTGGCTA X: 72,270,765 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Iqcf4 CCTTTTCC CCTTTTCCGTTTCCTTTTCCTTTTCCTTTGCCTTTTGCTTTTCC 9: 106,570,612 probably benign Het
Kmt2c TGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,315,760 probably benign Het
Mamld1 GCA GCAACA X: 71,118,839 probably benign Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nefh GCCTCACCTGGGGACTTG GCCTCACCTGGGGACTTGTCCTCACCTGGGGACTTG 11: 4,941,038 probably benign Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Pnmal1 TACCTCATGATGCACCTGCTTCAACA TACCTCATGATGCACCTGCTTCAACACCTCATGATGCACCTGCTTCAACA 7: 16,961,423 probably benign Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Smarca2 CAGCAGCAGCAGCA CAGCAGCAGCAGCAGCAGCA 19: 26,631,005 probably benign Het
Strn GTGCTCCCTTACCCCAGTC GTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCTTGCTCCCTTACCCCAGTC 17: 78,677,270 probably null Het
Strn TCCCTTACCCCAGTC TCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCCCCCTTACCCCAGTC 17: 78,677,274 probably null Het
Tfeb GCA GCACCA 17: 47,786,106 probably benign Het
Tfeb C CAGA 17: 47,786,116 probably benign Het
Tomm5 CATCTTCCG CATCTTCCGAATCTTCCG 4: 45,107,974 probably benign Het
Other mutations in Rbm33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Rbm33 APN 5 28410709 missense probably damaging 0.98
IGL01470:Rbm33 APN 5 28387848 missense probably damaging 1.00
IGL01565:Rbm33 APN 5 28391079 unclassified probably benign
IGL02119:Rbm33 APN 5 28339017 missense probably damaging 1.00
IGL02740:Rbm33 APN 5 28331123 missense probably damaging 1.00
IGL02869:Rbm33 APN 5 28410755 missense probably damaging 0.99
IGL03355:Rbm33 APN 5 28391061 unclassified probably benign
IGL03381:Rbm33 APN 5 28394392 missense unknown
FR4449:Rbm33 UTSW 5 28394168 small deletion probably benign
FR4548:Rbm33 UTSW 5 28394201 small deletion probably benign
R0091:Rbm33 UTSW 5 28352606 missense possibly damaging 0.94
R0725:Rbm33 UTSW 5 28394483 missense unknown
R1522:Rbm33 UTSW 5 28337004 missense probably damaging 1.00
R1918:Rbm33 UTSW 5 28387917 missense probably damaging 1.00
R2186:Rbm33 UTSW 5 28394230 missense unknown
R2448:Rbm33 UTSW 5 28342417 missense probably benign 0.01
R4151:Rbm33 UTSW 5 28387940 missense probably damaging 1.00
R4685:Rbm33 UTSW 5 28408282 unclassified probably benign
R4787:Rbm33 UTSW 5 28342437 intron probably null
R4954:Rbm33 UTSW 5 28339276 missense probably damaging 1.00
R5013:Rbm33 UTSW 5 28342411 missense probably benign 0.05
R5141:Rbm33 UTSW 5 28352689 missense probably damaging 1.00
R5248:Rbm33 UTSW 5 28337052 critical splice donor site probably null
R5259:Rbm33 UTSW 5 28352774 intron probably null
R5695:Rbm33 UTSW 5 28339012 missense probably damaging 1.00
R5790:Rbm33 UTSW 5 28339298 missense probably damaging 1.00
R6591:Rbm33 UTSW 5 28352546 missense probably damaging 0.99
R6668:Rbm33 UTSW 5 28342500 missense probably benign 0.01
R6691:Rbm33 UTSW 5 28352546 missense probably damaging 0.99
R6930:Rbm33 UTSW 5 28352506 missense probably benign 0.09
R6931:Rbm33 UTSW 5 28410745 missense probably damaging 1.00
R7034:Rbm33 UTSW 5 28394498 missense unknown
R7056:Rbm33 UTSW 5 28394003 unclassified probably benign
R7224:Rbm33 UTSW 5 28394324 missense
R7579:Rbm33 UTSW 5 28368266 missense probably damaging 1.00
R7922:Rbm33 UTSW 5 28368399 intron probably null
R8009:Rbm33 UTSW 5 28394608 missense not run
R8051:Rbm33 UTSW 5 28352625 missense not run
RF011:Rbm33 UTSW 5 28394181 small deletion probably benign
RF026:Rbm33 UTSW 5 28394181 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGCAAAGTGAACTGTGTTTTCC -3'
(R):5'- TTACCGCTTTGGGCTGAACG -3'

Sequencing Primer
(F):5'- TCCATTTTAGTTTCCTGATGAAGATG -3'
(R):5'- AACGCTAGCAGTGGTGATGTC -3'
Posted On2019-12-04