Incidental Mutation 'RF047:Pnmal1'
ID605046
Institutional Source Beutler Lab
Gene Symbol Pnmal1
Ensembl Gene ENSMUSG00000041141
Gene NamePNMA-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #RF047 (G1)
Quality Score215.25
Status Not validated
Chromosome7
Chromosomal Location16959679-16964607 bp(+) (GRCm38)
Type of Mutationsmall insertion (8 aa in frame mutation)
DNA Base Change (assembly) TACCTCATGATGCACCTGCTTCAACA to TACCTCATGATGCACCTGCTTCAACACCTCATGATGCACCTGCTTCAACA at 16961423 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038163]
Predicted Effect probably benign
Transcript: ENSMUST00000038163
SMART Domains Protein: ENSMUSP00000040929
Gene: ENSMUSG00000041141

DomainStartEndE-ValueType
Pfam:PNMA 5 364 6.9e-108 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 AAGA AA 5: 8,896,595 probably null Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,917 probably benign Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,923 probably benign Het
Cd109 TTATTTAT TTATTTATTTCTGTATTTAT 9: 78,712,527 probably benign Het
Dnah11 C A 12: 118,010,083 G2832V probably damaging Het
Dnmt1 GAGCACAGTTCCTACCTCGTT GAGCACAGTTCCTACCTCGTTTTGGGGGCGTAGCACAGTTCCTACCTCGTT 9: 20,910,125 probably null Het
Fam71e1 GAGGGAGGA GAGGGAGGAAGGCTGGATCCTGGATACCTGGGTCTTAGGGAGGA 7: 44,500,529 probably null Het
Fam71e1 G GCAGGGTGGATCCTGGATACCTGGGTCTGCGGGAGT 7: 44,500,536 probably null Het
Gab3 TCT TCTGCT X: 74,999,993 probably benign Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,053 probably benign Het
Gabre C CTGGCTA X: 72,270,765 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Iqcf4 CCTTTTCC CCTTTTCCGTTTCCTTTTCCTTTTCCTTTGCCTTTTGCTTTTCC 9: 106,570,612 probably benign Het
Kmt2c TGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,315,760 probably benign Het
Mamld1 GCA GCAACA X: 71,118,839 probably benign Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nefh GCCTCACCTGGGGACTTG GCCTCACCTGGGGACTTGTCCTCACCTGGGGACTTG 11: 4,941,038 probably benign Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm33 AGCAGCA AGCAGCACCAGCCGCAGCA 5: 28,394,162 probably benign Het
Smarca2 CAGCAGCAGCAGCA CAGCAGCAGCAGCAGCAGCA 19: 26,631,005 probably benign Het
Strn GTGCTCCCTTACCCCAGTC GTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCTTGCTCCCTTACCCCAGTC 17: 78,677,270 probably null Het
Strn TCCCTTACCCCAGTC TCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCCCCCTTACCCCAGTC 17: 78,677,274 probably null Het
Tfeb GCA GCACCA 17: 47,786,106 probably benign Het
Tfeb C CAGA 17: 47,786,116 probably benign Het
Tomm5 CATCTTCCG CATCTTCCGAATCTTCCG 4: 45,107,974 probably benign Het
Other mutations in Pnmal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Pnmal1 UTSW 7 16961425 small insertion probably benign
R0116:Pnmal1 UTSW 7 16960700 missense probably damaging 0.97
R0140:Pnmal1 UTSW 7 16960222 start codon destroyed probably null 0.00
R1109:Pnmal1 UTSW 7 16961467 nonsense probably null
R1306:Pnmal1 UTSW 7 16962025 missense probably benign 0.00
R1426:Pnmal1 UTSW 7 16960984 missense possibly damaging 0.56
R2000:Pnmal1 UTSW 7 16961039 missense probably benign 0.01
R2404:Pnmal1 UTSW 7 16960391 missense probably damaging 1.00
R3415:Pnmal1 UTSW 7 16960954 missense possibly damaging 0.74
R3708:Pnmal1 UTSW 7 16960225 missense probably damaging 1.00
R4009:Pnmal1 UTSW 7 16961376 missense probably damaging 1.00
R4105:Pnmal1 UTSW 7 16961179 missense possibly damaging 0.81
R5126:Pnmal1 UTSW 7 16961317 missense probably benign 0.03
R5244:Pnmal1 UTSW 7 16961323 missense probably damaging 0.99
R5825:Pnmal1 UTSW 7 16961095 missense probably benign 0.01
R5931:Pnmal1 UTSW 7 16960884 missense probably benign 0.31
R6128:Pnmal1 UTSW 7 16960736 missense probably benign 0.00
R7337:Pnmal1 UTSW 7 16961390 missense probably benign 0.35
R7756:Pnmal1 UTSW 7 16961299 missense probably benign 0.27
R7758:Pnmal1 UTSW 7 16961299 missense probably benign 0.27
RF007:Pnmal1 UTSW 7 16961424 small insertion probably benign
RF009:Pnmal1 UTSW 7 16961427 small insertion probably benign
RF020:Pnmal1 UTSW 7 16961451 small insertion probably benign
RF022:Pnmal1 UTSW 7 16961427 small insertion probably benign
RF029:Pnmal1 UTSW 7 16961444 nonsense probably null
RF039:Pnmal1 UTSW 7 16961444 small insertion probably benign
RF041:Pnmal1 UTSW 7 16961444 nonsense probably null
RF046:Pnmal1 UTSW 7 16961423 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CAGATCAAGATGGTGGACCG -3'
(R):5'- ATAATCCTCACCTGGGAGGGTAG -3'

Sequencing Primer
(F):5'- ATGGTGGACCGGAGAACCC -3'
(R):5'- TTTCCTCCCCCAATATCCTGAGG -3'
Posted On2019-12-04