Incidental Mutation 'RF047:Strn'
ID605059
Institutional Source Beutler Lab
Gene Symbol Strn
Ensembl Gene ENSMUSG00000024077
Gene Namestriatin, calmodulin binding protein
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.655) question?
Stock #RF047 (G1)
Quality Score211.468
Status Not validated
Chromosome17
Chromosomal Location78649913-78737196 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTGCTCCCTTACCCCAGTC to GTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCTTGCTCCCTTACCCCAGTC at 78677270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024881] [ENSMUST00000145910]
Predicted Effect probably null
Transcript: ENSMUST00000024881
SMART Domains Protein: ENSMUSP00000024881
Gene: ENSMUSG00000024077

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
low complexity region 178 195 N/A INTRINSIC
low complexity region 223 231 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
WD40 299 338 6.04e-8 SMART
WD40 352 391 2.42e-7 SMART
WD40 405 444 1.21e-7 SMART
WD40 493 539 1.28e1 SMART
WD40 542 581 4.4e-10 SMART
WD40 584 627 2.48e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000145480
SMART Domains Protein: ENSMUSP00000117663
Gene: ENSMUSG00000024077

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
low complexity region 153 171 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000145910
SMART Domains Protein: ENSMUSP00000120830
Gene: ENSMUSG00000024077

DomainStartEndE-ValueType
low complexity region 17 45 N/A INTRINSIC
Pfam:Striatin 48 177 4.2e-50 PFAM
low complexity region 238 254 N/A INTRINSIC
low complexity region 331 348 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 412 429 N/A INTRINSIC
WD40 452 491 6.04e-8 SMART
WD40 505 544 2.42e-7 SMART
WD40 558 597 1.21e-7 SMART
WD40 646 692 1.28e1 SMART
WD40 695 734 4.4e-10 SMART
WD40 737 780 2.48e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit increased blood pressure and circulating aldosterone when fed a liberal salt diet. No mice could be generated that were homozygous for the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 AAGA AA 5: 8,896,595 probably null Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,917 probably benign Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,923 probably benign Het
Cd109 TTATTTAT TTATTTATTTCTGTATTTAT 9: 78,712,527 probably benign Het
Dnah11 C A 12: 118,010,083 G2832V probably damaging Het
Dnmt1 GAGCACAGTTCCTACCTCGTT GAGCACAGTTCCTACCTCGTTTTGGGGGCGTAGCACAGTTCCTACCTCGTT 9: 20,910,125 probably null Het
Fam71e1 GAGGGAGGA GAGGGAGGAAGGCTGGATCCTGGATACCTGGGTCTTAGGGAGGA 7: 44,500,529 probably null Het
Fam71e1 G GCAGGGTGGATCCTGGATACCTGGGTCTGCGGGAGT 7: 44,500,536 probably null Het
Gab3 TCT TCTGCT X: 74,999,993 probably benign Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,053 probably benign Het
Gabre C CTGGCTA X: 72,270,765 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Iqcf4 CCTTTTCC CCTTTTCCGTTTCCTTTTCCTTTTCCTTTGCCTTTTGCTTTTCC 9: 106,570,612 probably benign Het
Kmt2c TGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT TGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 5: 25,315,760 probably benign Het
Mamld1 GCA GCAACA X: 71,118,839 probably benign Het
Mup21 TATACTT TATACTTTTTAGATACTT 4: 62,149,345 probably benign Het
Nefh GCCTCACCTGGGGACTTG GCCTCACCTGGGGACTTGTCCTCACCTGGGGACTTG 11: 4,941,038 probably benign Het
Plxnc1 C T 10: 94,865,007 C605Y probably damaging Het
Pnmal1 TACCTCATGATGCACCTGCTTCAACA TACCTCATGATGCACCTGCTTCAACACCTCATGATGCACCTGCTTCAACA 7: 16,961,423 probably benign Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm33 AGCAGCA AGCAGCACCAGCCGCAGCA 5: 28,394,162 probably benign Het
Smarca2 CAGCAGCAGCAGCA CAGCAGCAGCAGCAGCAGCA 19: 26,631,005 probably benign Het
Tfeb GCA GCACCA 17: 47,786,106 probably benign Het
Tfeb C CAGA 17: 47,786,116 probably benign Het
Tomm5 CATCTTCCG CATCTTCCGAATCTTCCG 4: 45,107,974 probably benign Het
Other mutations in Strn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Strn APN 17 78692420 missense possibly damaging 0.89
IGL02165:Strn APN 17 78687620 missense probably damaging 1.00
IGL02424:Strn APN 17 78684351 missense probably damaging 1.00
IGL02473:Strn APN 17 78684293 missense possibly damaging 0.71
IGL03306:Strn APN 17 78667223 missense probably damaging 0.98
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0165:Strn UTSW 17 78677374 missense possibly damaging 0.89
R1156:Strn UTSW 17 78656931 missense probably damaging 0.99
R1191:Strn UTSW 17 78692426 missense possibly damaging 0.82
R1256:Strn UTSW 17 78664617 critical splice donor site probably null
R1700:Strn UTSW 17 78692402 missense probably damaging 1.00
R1878:Strn UTSW 17 78677326 missense possibly damaging 0.81
R1897:Strn UTSW 17 78682842 missense probably benign 0.01
R1912:Strn UTSW 17 78684395 missense probably damaging 1.00
R1975:Strn UTSW 17 78692499 intron probably null
R2357:Strn UTSW 17 78655599 missense probably damaging 1.00
R3054:Strn UTSW 17 78682892 missense probably damaging 0.99
R3693:Strn UTSW 17 78656992 missense probably damaging 1.00
R3694:Strn UTSW 17 78656992 missense probably damaging 1.00
R3695:Strn UTSW 17 78656992 missense probably damaging 1.00
R3941:Strn UTSW 17 78657940 missense probably damaging 0.99
R4431:Strn UTSW 17 78736462 missense probably damaging 1.00
R4570:Strn UTSW 17 78677372 missense possibly damaging 0.95
R4678:Strn UTSW 17 78677351 missense probably damaging 1.00
R4729:Strn UTSW 17 78657961 missense probably damaging 0.98
R4947:Strn UTSW 17 78661779 missense probably damaging 0.98
R5470:Strn UTSW 17 78656945 missense probably benign 0.01
R5710:Strn UTSW 17 78687599 missense probably damaging 1.00
R5943:Strn UTSW 17 78669847 missense probably damaging 0.96
R6173:Strn UTSW 17 78700869 missense probably damaging 1.00
R6800:Strn UTSW 17 78670358 intron probably benign
R6846:Strn UTSW 17 78736457 missense probably damaging 0.97
R7716:Strn UTSW 17 78655775 missense probably damaging 0.99
R7746:Strn UTSW 17 78677372 missense probably benign 0.11
R7997:Strn UTSW 17 78684243 missense probably benign 0.01
RF006:Strn UTSW 17 78677271 frame shift probably null
RF008:Strn UTSW 17 78677287 frame shift probably null
RF017:Strn UTSW 17 78677288 frame shift probably null
RF018:Strn UTSW 17 78677283 frame shift probably null
RF031:Strn UTSW 17 78677277 frame shift probably null
RF035:Strn UTSW 17 78677285 frame shift probably null
RF036:Strn UTSW 17 78677277 frame shift probably null
RF038:Strn UTSW 17 78677282 frame shift probably null
RF039:Strn UTSW 17 78677278 frame shift probably null
RF044:Strn UTSW 17 78677288 frame shift probably null
RF045:Strn UTSW 17 78677282 frame shift probably null
RF047:Strn UTSW 17 78677274 frame shift probably null
RF048:Strn UTSW 17 78677287 frame shift probably null
X0022:Strn UTSW 17 78700949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTACACATTAGAGGAGGAGGC -3'
(R):5'- ACACAATGTGTCTGGCTGAG -3'

Sequencing Primer
(F):5'- GGAGGCAGCAGCTACAC -3'
(R):5'- ACACAATGTGTCTGGCTGAGTTAGG -3'
Posted On2019-12-04