Incidental Mutation 'R0128:Ablim2'
ID60508
Institutional Source Beutler Lab
Gene Symbol Ablim2
Ensembl Gene ENSMUSG00000029095
Gene Nameactin-binding LIM protein 2
Synonyms
MMRRC Submission 038413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R0128 (G1)
Quality Score174
Status Validated
Chromosome5
Chromosomal Location35757880-35884973 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 35809176 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054598] [ENSMUST00000101280] [ENSMUST00000114204] [ENSMUST00000114205] [ENSMUST00000114206] [ENSMUST00000114210] [ENSMUST00000129347]
Predicted Effect probably benign
Transcript: ENSMUST00000054598
SMART Domains Protein: ENSMUSP00000050571
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 477 489 N/A INTRINSIC
VHP 577 612 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101280
SMART Domains Protein: ENSMUSP00000098838
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 297 315 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
VHP 572 607 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114204
SMART Domains Protein: ENSMUSP00000109842
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
VHP 571 606 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114205
SMART Domains Protein: ENSMUSP00000109843
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 477 489 N/A INTRINSIC
VHP 538 573 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114206
SMART Domains Protein: ENSMUSP00000109844
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 375 384 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
VHP 582 617 2.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114210
SMART Domains Protein: ENSMUSP00000109848
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
low complexity region 278 296 N/A INTRINSIC
low complexity region 364 373 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129347
SMART Domains Protein: ENSMUSP00000123525
Gene: ENSMUSG00000029095

DomainStartEndE-ValueType
LIM 23 74 2.76e-8 SMART
LIM 82 134 1.26e-11 SMART
LIM 152 203 9.6e-17 SMART
LIM 211 263 4.96e-10 SMART
Pfam:AbLIM_anchor 295 513 2.1e-78 PFAM
Pfam:AbLIM_anchor 497 628 2.6e-37 PFAM
VHP 629 664 2.34e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,575,639 probably benign Het
Abcd4 T G 12: 84,612,352 Q210P possibly damaging Het
Actl6b A G 5: 137,555,065 N113S probably benign Het
Actn3 A T 19: 4,871,615 V179E probably damaging Het
Aff4 C A 11: 53,415,466 T1145N probably damaging Het
Ankrd42 G A 7: 92,591,859 Q431* probably null Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Asap3 C A 4: 136,234,604 N285K probably damaging Het
Atp6v0a2 A G 5: 124,713,184 N477S probably damaging Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
C87436 G A 6: 86,469,827 G533D probably damaging Het
Ccdc138 T A 10: 58,528,360 I314N probably damaging Het
Ccs A G 19: 4,825,626 F237S probably damaging Het
Ccz1 T G 5: 144,009,294 probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Chd1 A G 17: 17,393,567 N531S probably damaging Het
Clptm1 A T 7: 19,635,007 F476I probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dlg1 G T 16: 31,858,065 probably null Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Ergic3 C A 2: 156,011,140 R43S possibly damaging Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Ghrl A T 6: 113,717,168 probably benign Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm12166 A G 11: 46,052,293 M1T probably null Het
Gm4787 T A 12: 81,377,747 K546* probably null Het
Gm498 G T 7: 143,891,755 G178C probably damaging Het
Gm6576 C G 15: 27,026,000 noncoding transcript Het
Got1 C T 19: 43,524,377 D27N probably benign Het
Gucy2c C T 6: 136,704,249 V946I probably damaging Het
Hectd4 T C 5: 121,349,243 Y3434H possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Itpr1 A G 6: 108,471,209 probably benign Het
Kctd1 G A 18: 14,974,180 P743S probably benign Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Krt24 T C 11: 99,280,267 D495G probably damaging Het
L3hypdh C T 12: 72,077,143 probably null Het
Lipo3 C T 19: 33,557,106 probably null Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k4 T A 17: 12,248,063 D1104V probably damaging Het
Mpeg1 T C 19: 12,461,223 V15A probably benign Het
Narf C T 11: 121,250,836 R356C probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Olfm5 G A 7: 104,160,926 A76V probably benign Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr656 A T 7: 104,618,581 I301F probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Palb2 A T 7: 122,128,166 Y160* probably null Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pdcd11 G A 19: 47,119,862 V1223I probably benign Het
Pde6c T C 19: 38,169,365 probably benign Het
Prr12 A G 7: 45,050,039 probably benign Het
Prss39 T A 1: 34,502,200 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sfr1 A G 19: 47,735,018 *320W probably null Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Slc1a3 T C 15: 8,636,209 M519V probably benign Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Spag9 T A 11: 94,093,539 I327N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Unc79 A G 12: 103,088,434 probably benign Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Wrap73 A G 4: 154,142,500 D19G possibly damaging Het
Other mutations in Ablim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Ablim2 APN 5 35824015 unclassified probably benign
IGL00945:Ablim2 APN 5 35837020 missense probably damaging 1.00
IGL02439:Ablim2 APN 5 35857862 missense possibly damaging 0.89
IGL02664:Ablim2 APN 5 35849516 missense probably damaging 1.00
IGL02897:Ablim2 APN 5 35833126 missense probably damaging 1.00
IGL03034:Ablim2 APN 5 35828165 missense probably benign 0.00
IGL03096:Ablim2 APN 5 35883399 nonsense probably null
IGL03384:Ablim2 APN 5 35874872 missense probably damaging 1.00
R0130:Ablim2 UTSW 5 35809176 splice site probably benign
R0212:Ablim2 UTSW 5 35848910 splice site probably null
R0344:Ablim2 UTSW 5 35836933 splice site probably benign
R0675:Ablim2 UTSW 5 35866780 splice site probably benign
R0788:Ablim2 UTSW 5 35857901 missense probably benign 0.01
R1148:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1148:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1493:Ablim2 UTSW 5 35809261 missense probably damaging 1.00
R1809:Ablim2 UTSW 5 35843270 intron probably benign
R2070:Ablim2 UTSW 5 35798513 missense probably damaging 1.00
R2163:Ablim2 UTSW 5 35802353 splice site probably benign
R3962:Ablim2 UTSW 5 35812175 missense probably damaging 1.00
R4852:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4853:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4854:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4855:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4866:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4867:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4906:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4908:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4909:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R4927:Ablim2 UTSW 5 35802422 missense possibly damaging 0.85
R5210:Ablim2 UTSW 5 35837072 missense probably benign 0.44
R5225:Ablim2 UTSW 5 35866771 splice site probably null
R5439:Ablim2 UTSW 5 35857826 missense probably damaging 0.98
R5528:Ablim2 UTSW 5 35856166 nonsense probably null
R5629:Ablim2 UTSW 5 35857163 missense probably benign 0.01
R5653:Ablim2 UTSW 5 35883412 missense probably damaging 1.00
R5921:Ablim2 UTSW 5 35812211 missense probably damaging 1.00
R6059:Ablim2 UTSW 5 35857164 missense probably benign 0.37
R6241:Ablim2 UTSW 5 35874897 missense probably damaging 1.00
R7492:Ablim2 UTSW 5 35841329 missense probably benign 0.14
R7562:Ablim2 UTSW 5 35873219 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGCTACACAAATGCTCCCTTCAAC -3'
(R):5'- CACTTCAGCAGGACTACTGGGAAAG -3'

Sequencing Primer
(F):5'- TTCAACTGCCAGACAGGGTC -3'
(R):5'- TAGTCATTGCGCCAGGAC -3'
Posted On2013-07-24