Incidental Mutation 'RF048:Rnf144a'
ID605081
Institutional Source Beutler Lab
Gene Symbol Rnf144a
Ensembl Gene ENSMUSG00000020642
Gene Namering finger protein 144A
SynonymsUIP4, Rnf144
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF048 (G1)
Quality Score112.467
Status Not validated
Chromosome12
Chromosomal Location26300964-26415254 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) CTCTCTC to CTCTCTCTCTCTCTATCTCTC at 26314011 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020971] [ENSMUST00000062149]
Predicted Effect probably benign
Transcript: ENSMUST00000020971
SMART Domains Protein: ENSMUSP00000020971
Gene: ENSMUSG00000020642

DomainStartEndE-ValueType
RING 20 68 2.17e-1 SMART
IBR 91 156 6.4e-19 SMART
IBR 168 232 9.16e-1 SMART
RING 185 280 1.58e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062149
SMART Domains Protein: ENSMUSP00000056073
Gene: ENSMUSG00000020642

DomainStartEndE-ValueType
RING 20 68 2.17e-1 SMART
IBR 91 156 6.4e-19 SMART
IBR 168 232 9.16e-1 SMART
RING 185 280 1.58e0 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of RING finger domain-containing E3 ubiquitin ligases that also includes parkin and parc. The expression of this gene is induced by DNA damage. The encoded protein interacts with the cytoplasmic DNA-dependent protein kinase, catalytic subunit (DNA-PKcs) and promotes its degradation through ubiquitination. The orthologous mouse protein has been shown to interact with a ubiquitin-conjugating enzyme involved in embryonic development. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CATC CATCATC 2: 130,770,734 probably null Het
Akna GAGCTGA G 4: 63,377,841 probably benign Het
Celf4 G T 18: 25,501,321 P326T probably benign Het
Chga GCA GCACCA 12: 102,561,403 probably benign Het
Chga GCA GCATCA 12: 102,561,421 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cntnap1 AACCCC AACCCCCACCCC 11: 101,189,563 probably benign Het
Dnmt1 AGCACAGTTCCTACCTCGTT AGCACAGTTCCTACCTCGTTTTGGGGGCGGGGCACAGTTCCTACCTCGTT 9: 20,910,126 probably null Het
Gar1 CGCCGCCG C 3: 129,830,700 probably null Het
Gm15155 AA AACAACAAA X: 156,345,641 probably null Het
Lrmp GCACATTG GCACATTGAACACATTG 6: 145,173,784 probably benign Het
Mamld1 CA CAGTA X: 71,118,852 probably null Het
Ncoa6 CTGTTG CTG 2: 155,421,712 probably benign Het
Nefh CCTCAGCTGG CCTCAGCTGGAGACTTGGGCTCAGCTGG 11: 4,941,003 probably benign Het
Nefh AGCTGGGGAC AGCTGGGGACCTGGCCTCAGCTGGGGAC 11: 4,941,007 probably benign Het
Nphs2 GCCACC GCCACCCGAGGGGAGCCCCGAGCTCCAGCCTCCACC 1: 156,310,971 probably benign Het
Nup155 T TTTTTTG 15: 8,119,176 probably benign Het
Nusap1 AGCAAGCTGAGA AGCAAGCTGAGATACACGTTAGCATTGAGGCGCAAGCTGAGA 2: 119,627,599 probably benign Het
Pdik1l TGTTTT TGTTTTGTTTTGGTTTT 4: 134,279,372 probably null Het
Sbp G GCTGACAACAAAGATT 17: 23,945,389 probably benign Het
Strn TC TCCGTGCTCCCTTACCCCAGTGCGTGCGCCCTTACCCCAGAC 17: 78,677,287 probably null Het
Znrd1as CCACCACCACCAC CCACCACCACCACCCCCACCCACACCACCACCAC 17: 36,965,059 probably benign Het
Other mutations in Rnf144a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Rnf144a APN 12 26327301 missense probably benign 0.01
IGL02709:Rnf144a APN 12 26321010 missense probably damaging 1.00
R0432:Rnf144a UTSW 12 26339329 missense probably damaging 1.00
R3897:Rnf144a UTSW 12 26310713 missense probably damaging 1.00
R4087:Rnf144a UTSW 12 26327592 missense probably damaging 1.00
R4504:Rnf144a UTSW 12 26327303 missense probably benign 0.11
R5985:Rnf144a UTSW 12 26317780 missense probably benign 0.04
R6392:Rnf144a UTSW 12 26310780 missense possibly damaging 0.93
R7827:Rnf144a UTSW 12 26339440 start codon destroyed probably null 0.89
R8431:Rnf144a UTSW 12 26327301 missense probably damaging 1.00
RF018:Rnf144a UTSW 12 26314014 critical splice donor site probably benign
RF036:Rnf144a UTSW 12 26314008 critical splice donor site probably benign
RF036:Rnf144a UTSW 12 26314013 critical splice donor site probably benign
RF043:Rnf144a UTSW 12 26314014 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CTAGAAAACACATTCCTGTCTTCTG -3'
(R):5'- CACACCGGGTATCTGGAAAGATC -3'

Sequencing Primer
(F):5'- ACACATTCCTGTCTTCTGAAAAATAC -3'
(R):5'- AGATCAAACAAACTGAAGCGTTC -3'
Posted On2019-12-04