Incidental Mutation 'RF048:Znrd1as'
ID605086
Institutional Source Beutler Lab
Gene Symbol Znrd1as
Ensembl Gene ENSMUSG00000036214
Gene Namezinc ribbon domain containing 1, antisense
Synonyms1700022C21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #RF048 (G1)
Quality Score112.467
Status Not validated
Chromosome17
Chromosomal Location36958592-36965625 bp(+) (GRCm38)
Type of Mutationsmall insertion (7 aa in frame mutation)
DNA Base Change (assembly) CCACCACCACCAC to CCACCACCACCACCCCCACCCACACCACCACCAC at 36965059 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040177] [ENSMUST00000173814] [ENSMUST00000209623]
Predicted Effect probably benign
Transcript: ENSMUST00000040177
SMART Domains Protein: ENSMUSP00000048695
Gene: ENSMUSG00000036214

DomainStartEndE-ValueType
low complexity region 98 115 N/A INTRINSIC
coiled coil region 163 195 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173814
SMART Domains Protein: ENSMUSP00000134016
Gene: ENSMUSG00000036214

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
coiled coil region 84 116 N/A INTRINSIC
low complexity region 145 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209623
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CATC CATCATC 2: 130,770,734 probably null Het
Akna GAGCTGA G 4: 63,377,841 probably benign Het
Celf4 G T 18: 25,501,321 P326T probably benign Het
Chga GCA GCACCA 12: 102,561,403 probably benign Het
Chga GCA GCATCA 12: 102,561,421 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cntnap1 AACCCC AACCCCCACCCC 11: 101,189,563 probably benign Het
Dnmt1 AGCACAGTTCCTACCTCGTT AGCACAGTTCCTACCTCGTTTTGGGGGCGGGGCACAGTTCCTACCTCGTT 9: 20,910,126 probably null Het
Gar1 CGCCGCCG C 3: 129,830,700 probably null Het
Gm15155 AA AACAACAAA X: 156,345,641 probably null Het
Lrmp GCACATTG GCACATTGAACACATTG 6: 145,173,784 probably benign Het
Mamld1 CA CAGTA X: 71,118,852 probably null Het
Ncoa6 CTGTTG CTG 2: 155,421,712 probably benign Het
Nefh CCTCAGCTGG CCTCAGCTGGAGACTTGGGCTCAGCTGG 11: 4,941,003 probably benign Het
Nefh AGCTGGGGAC AGCTGGGGACCTGGCCTCAGCTGGGGAC 11: 4,941,007 probably benign Het
Nphs2 GCCACC GCCACCCGAGGGGAGCCCCGAGCTCCAGCCTCCACC 1: 156,310,971 probably benign Het
Nup155 T TTTTTTG 15: 8,119,176 probably benign Het
Nusap1 AGCAAGCTGAGA AGCAAGCTGAGATACACGTTAGCATTGAGGCGCAAGCTGAGA 2: 119,627,599 probably benign Het
Pdik1l TGTTTT TGTTTTGTTTTGGTTTT 4: 134,279,372 probably null Het
Rnf144a CTCTCTC CTCTCTCTCTCTCTATCTCTC 12: 26,314,011 probably benign Het
Sbp G GCTGACAACAAAGATT 17: 23,945,389 probably benign Het
Strn TC TCCGTGCTCCCTTACCCCAGTGCGTGCGCCCTTACCCCAGAC 17: 78,677,287 probably null Het
Other mutations in Znrd1as
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Znrd1as APN 17 36964921 missense probably damaging 0.99
R0347:Znrd1as UTSW 17 36965315 missense probably damaging 1.00
R0789:Znrd1as UTSW 17 36964960 missense probably damaging 1.00
R0993:Znrd1as UTSW 17 36965047 small deletion probably benign
R2110:Znrd1as UTSW 17 36965444 missense possibly damaging 0.47
R2866:Znrd1as UTSW 17 36965160 missense possibly damaging 0.91
R4224:Znrd1as UTSW 17 36958725 utr 5 prime probably benign
R4746:Znrd1as UTSW 17 36964873 missense probably benign 0.00
R7449:Znrd1as UTSW 17 36964383 missense probably damaging 1.00
RF005:Znrd1as UTSW 17 36965048 small insertion probably benign
RF008:Znrd1as UTSW 17 36965054 small insertion probably benign
RF010:Znrd1as UTSW 17 36965063 small insertion probably benign
RF014:Znrd1as UTSW 17 36965060 small insertion probably benign
RF024:Znrd1as UTSW 17 36965057 small insertion probably benign
RF025:Znrd1as UTSW 17 36965048 small insertion probably benign
RF029:Znrd1as UTSW 17 36965071 small insertion probably benign
RF035:Znrd1as UTSW 17 36965066 small insertion probably benign
RF046:Znrd1as UTSW 17 36965057 small insertion probably benign
RF053:Znrd1as UTSW 17 36965066 small insertion probably benign
RF064:Znrd1as UTSW 17 36965050 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTGCATACAACAGCAGCAAG -3'
(R):5'- GTGGGATGCTTTCCTCCTCTAG -3'

Sequencing Primer
(F):5'- CTTGATAACTCAGAAATGCCATGAGG -3'
(R):5'- TCCTCTAGCACAATTTTGGGTAG -3'
Posted On2019-12-04