Incidental Mutation 'RF048:Celf4'
ID605088
Institutional Source Beutler Lab
Gene Symbol Celf4
Ensembl Gene ENSMUSG00000024268
Gene NameCUGBP, Elav-like family member 4
SynonymsBrunol4, Brul4, BRUNOL-4, A230070D14Rik, C130060B05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF048 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location25477632-25754157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25501321 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 326 (P326T)
Ref Sequence ENSEMBL: ENSMUSP00000111483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025117] [ENSMUST00000115816] [ENSMUST00000223704] [ENSMUST00000224553] [ENSMUST00000225477]
Predicted Effect probably benign
Transcript: ENSMUST00000025117
AA Change: P316T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025117
Gene: ENSMUSG00000024268
AA Change: P316T

DomainStartEndE-ValueType
RRM 55 131 2.94e-21 SMART
RRM 152 227 3.56e-20 SMART
low complexity region 237 249 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
low complexity region 287 309 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
RRM 420 473 5.29e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115816
AA Change: P326T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111483
Gene: ENSMUSG00000024268
AA Change: P326T

DomainStartEndE-ValueType
RRM 55 131 2.94e-21 SMART
RRM 152 227 3.56e-20 SMART
low complexity region 237 249 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
low complexity region 287 309 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
RRM 420 493 5.88e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223704
AA Change: P327T

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224553
AA Change: P326T

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000225477
AA Change: P326T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, shortened life span dependent on genetic background, and seizures. Mice heterozygous for a null allele exhibit complex seizures and abnormal body weights depending on age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CATC CATCATC 2: 130,770,734 probably null Het
Akna GAGCTGA G 4: 63,377,841 probably benign Het
Chga GCA GCACCA 12: 102,561,403 probably benign Het
Chga GCA GCATCA 12: 102,561,421 probably benign Het
Cntnap1 TTT TTTTGTT 11: 101,180,305 probably benign Het
Cntnap1 AACCCC AACCCCCACCCC 11: 101,189,563 probably benign Het
Dnmt1 AGCACAGTTCCTACCTCGTT AGCACAGTTCCTACCTCGTTTTGGGGGCGGGGCACAGTTCCTACCTCGTT 9: 20,910,126 probably null Het
Gar1 CGCCGCCG C 3: 129,830,700 probably null Het
Gm15155 AA AACAACAAA X: 156,345,641 probably null Het
Lrmp GCACATTG GCACATTGAACACATTG 6: 145,173,784 probably benign Het
Mamld1 CA CAGTA X: 71,118,852 probably null Het
Ncoa6 CTGTTG CTG 2: 155,421,712 probably benign Het
Nefh CCTCAGCTGG CCTCAGCTGGAGACTTGGGCTCAGCTGG 11: 4,941,003 probably benign Het
Nefh AGCTGGGGAC AGCTGGGGACCTGGCCTCAGCTGGGGAC 11: 4,941,007 probably benign Het
Nphs2 GCCACC GCCACCCGAGGGGAGCCCCGAGCTCCAGCCTCCACC 1: 156,310,971 probably benign Het
Nup155 T TTTTTTG 15: 8,119,176 probably benign Het
Nusap1 AGCAAGCTGAGA AGCAAGCTGAGATACACGTTAGCATTGAGGCGCAAGCTGAGA 2: 119,627,599 probably benign Het
Pdik1l TGTTTT TGTTTTGTTTTGGTTTT 4: 134,279,372 probably null Het
Rnf144a CTCTCTC CTCTCTCTCTCTCTATCTCTC 12: 26,314,011 probably benign Het
Sbp G GCTGACAACAAAGATT 17: 23,945,389 probably benign Het
Strn TC TCCGTGCTCCCTTACCCCAGTGCGTGCGCCCTTACCCCAGAC 17: 78,677,287 probably null Het
Znrd1as CCACCACCACCAC CCACCACCACCACCCCCACCCACACCACCACCAC 17: 36,965,059 probably benign Het
Other mutations in Celf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Celf4 APN 18 25486950 missense probably damaging 1.00
IGL01608:Celf4 APN 18 25497503 missense probably damaging 1.00
IGL02353:Celf4 APN 18 25486898 missense probably damaging 1.00
IGL02360:Celf4 APN 18 25486898 missense probably damaging 1.00
IGL02614:Celf4 APN 18 25504150 missense probably damaging 1.00
IGL03183:Celf4 APN 18 25537739 missense probably benign 0.05
IGL03183:Celf4 APN 18 25537740 missense probably benign 0.22
R1141:Celf4 UTSW 18 25504904 missense probably damaging 0.99
R1448:Celf4 UTSW 18 25503083 splice site probably null
R2442:Celf4 UTSW 18 25753459 missense probably damaging 1.00
R3958:Celf4 UTSW 18 25537754 missense probably benign 0.08
R3959:Celf4 UTSW 18 25537754 missense probably benign 0.08
R3960:Celf4 UTSW 18 25537754 missense probably benign 0.08
R4256:Celf4 UTSW 18 25491201 missense probably damaging 0.97
R4650:Celf4 UTSW 18 25496245 missense possibly damaging 0.79
R6521:Celf4 UTSW 18 25479474 splice site probably null
R6945:Celf4 UTSW 18 25496236 missense probably damaging 1.00
R7724:Celf4 UTSW 18 25486793 critical splice donor site probably null
R7834:Celf4 UTSW 18 25753485 missense probably benign 0.04
R8000:Celf4 UTSW 18 25504517 missense probably benign 0.00
R8403:Celf4 UTSW 18 25504270 missense possibly damaging 0.90
Z1088:Celf4 UTSW 18 25496249 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGGCATGATCAGAGGTCTG -3'
(R):5'- GCATAGTTTGCCACCAAGATAGG -3'

Sequencing Primer
(F):5'- CCTTCTTCTAACAGTGAGTCAAGG -3'
(R):5'- CCACCAAGATAGGGTAGCTATG -3'
Posted On2019-12-04