Incidental Mutation 'RF049:Sirpa'
Institutional Source Beutler Lab
Gene Symbol Sirpa
Ensembl Gene ENSMUSG00000037902
Gene Namesignal-regulatory protein alpha
SynonymsSIRP, Ptpns1, CD172a, P84, SHPS-1, Bit
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF049 (G1)
Quality Score214.459
Status Not validated
Chromosomal Location129592835-129632228 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) TCATCAG to T at 129609203 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049262] [ENSMUST00000099113] [ENSMUST00000103202] [ENSMUST00000103203] [ENSMUST00000153491] [ENSMUST00000160276] [ENSMUST00000161620] [ENSMUST00000163034] [ENSMUST00000179001]
Predicted Effect probably null
Transcript: ENSMUST00000049262
SMART Domains Protein: ENSMUSP00000049022
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099113
SMART Domains Protein: ENSMUSP00000096713
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 228 240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103202
SMART Domains Protein: ENSMUSP00000099491
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103203
SMART Domains Protein: ENSMUSP00000099492
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153491
SMART Domains Protein: ENSMUSP00000120324
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160276
SMART Domains Protein: ENSMUSP00000125004
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161620
SMART Domains Protein: ENSMUSP00000124048
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163034
SMART Domains Protein: ENSMUSP00000124888
Gene: ENSMUSG00000037902

signal peptide 1 26 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179001
SMART Domains Protein: ENSMUSP00000137611
Gene: ENSMUSG00000037902

signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the signal-regulatory-protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. This protein can be phosphorylated by tyrosine kinases. The phospho-tyrosine residues of this PTP have been shown to recruit SH2 domain containing tyrosine phosphatases (PTP), and serve as substrates of PTPs. This protein was found to participate in signal transduction mediated by various growth factor receptors. CD47 has been demonstrated to be a ligand for this receptor protein. This gene and its product share very high similarity with several other members of the SIRP family. These related genes are located in close proximity to each other on chromosome 20p13. Multiple alternatively spliced transcript variants have been determined for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display mild thrombocytopenia, fatty livers, decreased body weight, decreased proportion of single positive T cells, enhanced peritoneal macrophage phagocytosis and impaired Langerhans cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b GTAGGA G 5: 25,848,488 probably benign Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,923 probably benign Het
Begain GCGCCCCCGCC GCGCCCCCGCCCCCGCC 12: 109,033,414 probably benign Het
Cdx1 GGGGCTG GGGGCTGGGGCTG 18: 61,019,866 probably benign Het
Chga AGC AGCCGC 12: 102,561,393 probably benign Het
Cntnap1 CAGCC CAGCCCTAGCC 11: 101,189,592 probably benign Het
Cntnap1 C CCCAGCA 11: 101,189,596 probably benign Het
Gabre CTCAGGCTGGGG C X: 72,270,277 probably null Het
Hsdl2 AG AGATGCAGCAGCAGCCACGG 4: 59,610,651 probably benign Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,138 probably benign Het
Krtap28-10 CACAGC CACAGCCACAGCCACAACAGC 1: 83,042,285 probably benign Het
Mamld1 GCA GCATCA X: 71,118,833 probably benign Het
Mamld1 GCA GCATCA X: 71,118,845 probably benign Het
Med12l CAG CAGAAG 3: 59,275,969 probably benign Het
Tspan33 G GCTGT 6: 29,709,998 probably benign Het
Vmn1r74 CAGAGCCACCAAGTACCT C 7: 11,847,140 probably null Het
Zkscan4 AAAAA AAAAAA 13: 21,484,711 probably null Het
Other mutations in Sirpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Sirpa APN 2 129609183 missense probably damaging 1.00
IGL01138:Sirpa APN 2 129630165 missense probably damaging 1.00
IGL01835:Sirpa APN 2 129615564 missense possibly damaging 0.76
IGL02558:Sirpa APN 2 129630069 missense probably damaging 1.00
IGL02825:Sirpa APN 2 129615452 missense probably damaging 0.99
IGL03083:Sirpa APN 2 129629928 missense probably damaging 1.00
R0234:Sirpa UTSW 2 129615468 missense probably damaging 0.99
R0234:Sirpa UTSW 2 129615468 missense probably damaging 0.99
R0831:Sirpa UTSW 2 129627936 splice site probably benign
R1550:Sirpa UTSW 2 129630041 missense probably damaging 1.00
R1772:Sirpa UTSW 2 129616456 missense probably damaging 0.99
R1806:Sirpa UTSW 2 129615512 missense probably damaging 1.00
R1927:Sirpa UTSW 2 129616376 missense possibly damaging 0.46
R2568:Sirpa UTSW 2 129615648 missense probably benign 0.02
R4849:Sirpa UTSW 2 129609243 missense probably damaging 1.00
R5182:Sirpa UTSW 2 129615732 missense possibly damaging 0.65
R5673:Sirpa UTSW 2 129630102 missense probably damaging 1.00
R5680:Sirpa UTSW 2 129616252 missense probably benign 0.02
R6521:Sirpa UTSW 2 129630155 missense probably damaging 1.00
R6821:Sirpa UTSW 2 129630097 missense probably damaging 1.00
R7602:Sirpa UTSW 2 129609152 missense probably damaging 1.00
R7637:Sirpa UTSW 2 129616445 missense probably benign 0.44
R8311:Sirpa UTSW 2 129616223 missense probably damaging 1.00
RF018:Sirpa UTSW 2 129609203 nonsense probably null
Z1088:Sirpa UTSW 2 129618535 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04