Incidental Mutation 'RF049:Cdx1'
ID605116
Institutional Source Beutler Lab
Gene Symbol Cdx1
Ensembl Gene ENSMUSG00000024619
Gene Namecaudal type homeobox 1
SynonymsCdx-1, Cdx
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #RF049 (G1)
Quality Score179.468
Status Not validated
Chromosome18
Chromosomal Location61018862-61036199 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GGGGCTG to GGGGCTGGGGCTG at 61019866 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025521]
Predicted Effect probably benign
Transcript: ENSMUST00000025521
SMART Domains Protein: ENSMUSP00000025521
Gene: ENSMUSG00000024619

DomainStartEndE-ValueType
Pfam:Caudal_act 13 146 4.8e-31 PFAM
HOX 154 216 1.3e-25 SMART
low complexity region 217 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the caudal-related homeobox transcription factor gene family. The encoded DNA-binding protein regulates intestine-specific gene expression and enterocyte differentiation. It has been shown to induce expression of the intestinal alkaline phosphatase gene, and inhibit beta-catenin/T-cell factor transcriptional activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in abnormalities of the basiocciptal bone, vertebrae, and ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b GTAGGA G 5: 25,848,488 probably benign Het
Ankhd1 CGGCGG CGGCGGAGGCGG 18: 36,560,923 probably benign Het
Begain GCGCCCCCGCC GCGCCCCCGCCCCCGCC 12: 109,033,414 probably benign Het
Chga AGC AGCCGC 12: 102,561,393 probably benign Het
Cntnap1 CAGCC CAGCCCTAGCC 11: 101,189,592 probably benign Het
Cntnap1 C CCCAGCA 11: 101,189,596 probably benign Het
Flywch1 CCTGGTGT CCTGGTGTGGGGAGGCTACGTACTCACCCACTTCTGGTGT 17: 23,762,171 probably null Het
Gabre CTCAGGCTGGGG C X: 72,270,277 probably null Het
Hsdl2 AGCTGCAGGAGCAGCCACAGCTGCAGGAG AGCTGCAGGAGCCGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAG 4: 59,610,633 probably benign Het
Hsdl2 AG AGATGCAGCAGCAGCCACGG 4: 59,610,651 probably benign Het
Krtap28-10 CACAGC CACAGCAACAGC 1: 83,042,138 probably benign Het
Krtap28-10 CACAGC CACAGCCACAGCCACAACAGC 1: 83,042,285 probably benign Het
Lkaaear1 CTCCAGCTCCAGCTCCAGCTCCAG CTCCAGCTCCAGTTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,574 probably benign Het
Mamld1 GCA GCATCA X: 71,118,833 probably benign Het
Mamld1 GCA GCATCA X: 71,118,845 probably benign Het
Med12l CAG CAGAAG 3: 59,275,969 probably benign Het
Nefh ACTTGGCCTCAGCTGG ACTTGGCCTCAGCTGGAGCCTTGGCCTCAGCTGG 11: 4,940,997 probably benign Het
Nusap1 CACGTTAGCAGTGAGGAGCAAGCTGAGA CACGTTAGCAGTCAGGAGCAAGCTGAGATAGACGTTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,583 probably benign Het
Rassf6 ACTCATGGTCCTGTAGAGCAATGGGGATTC ACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTCGCTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,913 probably benign Het
Sfswap TCGGCCCACTCAGCCCACTCGGCC TCGGCCCACTCGGCCCACTCAGCCCACTCGGCC 5: 129,569,744 probably benign Het
Sirpa TCATCAG T 2: 129,609,203 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,301 probably benign Het
Trappc9 CTGCTGCTGCTGCTG CTGCTGCTGCTGCTGATGCTGCTGCTGCTG 15: 72,801,306 probably benign Het
Triobp GACAA GACAACCCCAGGACTCCCTGTACCCAACGGAACAA 15: 78,967,061 probably benign Het
Tspan33 G GCTGT 6: 29,709,998 probably benign Het
Vmn1r74 CAGAGCCACCAAGTACCT C 7: 11,847,140 probably null Het
Zkscan4 AAAAA AAAAAA 13: 21,484,711 probably null Het
Other mutations in Cdx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0370:Cdx1 UTSW 18 61020429 missense probably damaging 1.00
FR4449:Cdx1 UTSW 18 61019881 small insertion probably benign
FR4737:Cdx1 UTSW 18 61019874 small insertion probably benign
FR4737:Cdx1 UTSW 18 61019878 small insertion probably benign
FR4976:Cdx1 UTSW 18 61019867 small insertion probably benign
FR4976:Cdx1 UTSW 18 61019869 small insertion probably benign
R0218:Cdx1 UTSW 18 61020364 splice site probably benign
R0481:Cdx1 UTSW 18 61020492 missense probably damaging 1.00
R1776:Cdx1 UTSW 18 61036014 missense probably benign 0.01
R1914:Cdx1 UTSW 18 61019898 missense probably benign 0.01
R1915:Cdx1 UTSW 18 61019898 missense probably benign 0.01
R2094:Cdx1 UTSW 18 61035912 missense possibly damaging 0.85
R4191:Cdx1 UTSW 18 61020438 missense possibly damaging 0.88
R5671:Cdx1 UTSW 18 61019899 missense probably benign 0.01
R8145:Cdx1 UTSW 18 61019923 missense probably damaging 1.00
RF036:Cdx1 UTSW 18 61019870 small insertion probably benign
RF038:Cdx1 UTSW 18 61019870 small insertion probably benign
RF039:Cdx1 UTSW 18 61019870 small insertion probably benign
RF040:Cdx1 UTSW 18 61019870 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACTCAGAACAGGTCCTTGGG -3'
(R):5'- GTCACAGAACACAGGAGCTC -3'

Sequencing Primer
(F):5'- TCCTTGGGCCCCAGAAAAG -3'
(R):5'- CTCTGGAGAACTGGGGCCTTG -3'
Posted On2019-12-04