Incidental Mutation 'RF051:Map1a'
ID 605134
Institutional Source Beutler Lab
Gene Symbol Map1a
Ensembl Gene ENSMUSG00000027254
Gene Name microtubule-associated protein 1 A
Synonyms Mtap1a, Mtap-1, 6330416M19Rik, Mtap1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # RF051 (G1)
Quality Score 217.468
Status Not validated
Chromosome 2
Chromosomal Location 121120081-121141313 bp(+) (GRCm39)
Type of Mutation small insertion (10 aa in frame mutation)
DNA Base Change (assembly) CTCCAGCTCCAGCTCCAGCTCCA to CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA at 121136777 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000094639] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000110639]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000052029
SMART Domains Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.8e-110 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094639
SMART Domains Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254

DomainStartEndE-ValueType
Blast:Lactamase_B 286 538 2e-54 BLAST
SCOP:d1eq1a_ 584 699 8e-5 SMART
low complexity region 743 755 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
low complexity region 852 867 N/A INTRINSIC
low complexity region 897 911 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1334 1344 N/A INTRINSIC
low complexity region 1540 1555 N/A INTRINSIC
coiled coil region 1573 1602 N/A INTRINSIC
internal_repeat_1 1616 1726 7.66e-6 PROSPERO
coiled coil region 1747 1771 N/A INTRINSIC
internal_repeat_1 1774 1888 7.66e-6 PROSPERO
low complexity region 2060 2084 N/A INTRINSIC
low complexity region 2121 2133 N/A INTRINSIC
low complexity region 2156 2169 N/A INTRINSIC
low complexity region 2383 2396 N/A INTRINSIC
low complexity region 2436 2460 N/A INTRINSIC
low complexity region 2517 2541 N/A INTRINSIC
low complexity region 2589 2600 N/A INTRINSIC
low complexity region 2662 2682 N/A INTRINSIC
low complexity region 2685 2704 N/A INTRINSIC
low complexity region 2716 2728 N/A INTRINSIC
low complexity region 2766 2790 N/A INTRINSIC
low complexity region 2980 2988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110625
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110626
SMART Domains Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 1.1e-135 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110627
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110628
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110639
SMART Domains Protein: ENSMUSP00000106269
Gene: ENSMUSG00000027254

DomainStartEndE-ValueType
Blast:Lactamase_B 48 300 3e-54 BLAST
SCOP:d1eq1a_ 346 461 1e-4 SMART
low complexity region 505 517 N/A INTRINSIC
low complexity region 582 595 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1302 1317 N/A INTRINSIC
coiled coil region 1335 1364 N/A INTRINSIC
internal_repeat_1 1378 1488 5.43e-6 PROSPERO
coiled coil region 1509 1533 N/A INTRINSIC
internal_repeat_1 1536 1650 5.43e-6 PROSPERO
low complexity region 1822 1846 N/A INTRINSIC
low complexity region 1883 1895 N/A INTRINSIC
low complexity region 1918 1931 N/A INTRINSIC
low complexity region 2145 2158 N/A INTRINSIC
low complexity region 2198 2222 N/A INTRINSIC
low complexity region 2279 2303 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
low complexity region 2424 2444 N/A INTRINSIC
low complexity region 2447 2466 N/A INTRINSIC
low complexity region 2478 2490 N/A INTRINSIC
low complexity region 2528 2552 N/A INTRINSIC
low complexity region 2742 2750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit Purkinje cell degeneration. Mice homozygous for a spontaneous mutation exhibit mild ataxia and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 47,047,674 (GRCm39) probably benign Het
Gabre CTCCGG CTCCGGGTCCGG X: 71,313,655 (GRCm39) probably benign Het
Garin5a GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,149,947 (GRCm39) probably null Het
Gm14399 G C 2: 174,972,994 (GRCm39) Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 (GRCm39) probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 (GRCm39) probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,179,990 (GRCm39) probably benign Het
Kmt2c CCTTCT CCT 5: 25,518,477 (GRCm39) probably benign Het
Manbal CGATAGAAT C 2: 157,237,932 (GRCm39) probably null Het
Mei1 GC GCTGGCTGCC 15: 81,954,211 (GRCm39) probably null Het
Nalf2 GCCGCC GCCGCCACCGCC X: 98,864,968 (GRCm39) probably benign Het
Nbea TTTA T 3: 55,916,633 (GRCm39) probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,891,054 (GRCm39) probably benign Het
Or2b7 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,739,693 (GRCm39) probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,134,010 (GRCm39) probably benign Het
Plekhg2 GGTG GG 7: 28,061,777 (GRCm39) probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,756,788 (GRCm39) probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,608,388 (GRCm39) probably benign Het
Stard8 GAG GAGCAG X: 98,110,130 (GRCm39) probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,966,651 (GRCm39) probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,851,234 (GRCm39) probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,000,426 (GRCm39) probably benign Het
Other mutations in Map1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Map1a APN 2 121,129,508 (GRCm39) missense probably damaging 0.99
IGL00826:Map1a APN 2 121,132,757 (GRCm39) missense possibly damaging 0.87
IGL01476:Map1a APN 2 121,135,688 (GRCm39) missense probably damaging 1.00
IGL02029:Map1a APN 2 121,133,779 (GRCm39) missense possibly damaging 0.57
IGL02100:Map1a APN 2 121,133,327 (GRCm39) missense probably damaging 0.99
IGL02136:Map1a APN 2 121,130,693 (GRCm39) missense probably damaging 1.00
IGL02146:Map1a APN 2 121,129,927 (GRCm39) missense probably damaging 1.00
IGL02264:Map1a APN 2 121,137,794 (GRCm39) missense probably damaging 1.00
IGL02456:Map1a APN 2 121,129,134 (GRCm39) missense probably damaging 1.00
IGL02485:Map1a APN 2 121,129,769 (GRCm39) missense probably damaging 1.00
IGL02535:Map1a APN 2 121,132,658 (GRCm39) nonsense probably null
IGL02628:Map1a APN 2 121,130,585 (GRCm39) missense probably damaging 1.00
IGL02721:Map1a APN 2 121,134,518 (GRCm39) missense probably benign 0.44
IGL03273:Map1a APN 2 121,130,719 (GRCm39) missense probably damaging 1.00
IGL03281:Map1a APN 2 121,135,541 (GRCm39) missense probably damaging 1.00
IGL02991:Map1a UTSW 2 121,132,091 (GRCm39) missense probably damaging 0.99
R0096:Map1a UTSW 2 121,131,986 (GRCm39) missense probably damaging 1.00
R0096:Map1a UTSW 2 121,131,986 (GRCm39) missense probably damaging 1.00
R0218:Map1a UTSW 2 121,135,906 (GRCm39) missense probably benign 0.00
R0363:Map1a UTSW 2 121,132,525 (GRCm39) missense probably damaging 1.00
R0450:Map1a UTSW 2 121,136,255 (GRCm39) missense probably benign 0.27
R0469:Map1a UTSW 2 121,136,255 (GRCm39) missense probably benign 0.27
R0477:Map1a UTSW 2 121,132,582 (GRCm39) missense probably damaging 1.00
R0504:Map1a UTSW 2 121,133,422 (GRCm39) missense probably benign 0.03
R0510:Map1a UTSW 2 121,136,255 (GRCm39) missense probably benign 0.27
R0521:Map1a UTSW 2 121,136,234 (GRCm39) missense probably damaging 1.00
R0601:Map1a UTSW 2 121,129,083 (GRCm39) missense probably damaging 1.00
R0619:Map1a UTSW 2 121,135,736 (GRCm39) missense probably damaging 0.96
R0633:Map1a UTSW 2 121,138,495 (GRCm39) missense probably damaging 1.00
R0652:Map1a UTSW 2 121,133,264 (GRCm39) missense probably benign 0.04
R0893:Map1a UTSW 2 121,131,014 (GRCm39) missense probably damaging 1.00
R0960:Map1a UTSW 2 121,132,124 (GRCm39) missense probably benign 0.16
R1115:Map1a UTSW 2 121,137,859 (GRCm39) splice site probably null
R1166:Map1a UTSW 2 121,130,741 (GRCm39) missense probably damaging 1.00
R1326:Map1a UTSW 2 121,136,671 (GRCm39) nonsense probably null
R1331:Map1a UTSW 2 121,136,701 (GRCm39) nonsense probably null
R1395:Map1a UTSW 2 121,134,406 (GRCm39) missense probably benign 0.26
R1489:Map1a UTSW 2 121,130,918 (GRCm39) missense possibly damaging 0.91
R1573:Map1a UTSW 2 121,134,607 (GRCm39) missense probably benign 0.37
R1596:Map1a UTSW 2 121,120,246 (GRCm39) missense probably benign 0.00
R1662:Map1a UTSW 2 121,136,889 (GRCm39) missense possibly damaging 0.90
R1675:Map1a UTSW 2 121,133,136 (GRCm39) nonsense probably null
R1919:Map1a UTSW 2 121,137,493 (GRCm39) missense probably damaging 1.00
R2122:Map1a UTSW 2 121,129,927 (GRCm39) missense probably damaging 1.00
R2126:Map1a UTSW 2 121,129,122 (GRCm39) missense probably damaging 0.96
R2143:Map1a UTSW 2 121,132,426 (GRCm39) missense probably damaging 1.00
R2172:Map1a UTSW 2 121,138,413 (GRCm39) missense probably damaging 1.00
R2249:Map1a UTSW 2 121,130,768 (GRCm39) missense probably damaging 1.00
R2254:Map1a UTSW 2 121,134,272 (GRCm39) missense possibly damaging 0.71
R2255:Map1a UTSW 2 121,134,272 (GRCm39) missense possibly damaging 0.71
R3834:Map1a UTSW 2 121,137,803 (GRCm39) missense probably damaging 1.00
R4011:Map1a UTSW 2 121,130,608 (GRCm39) missense probably damaging 1.00
R4346:Map1a UTSW 2 121,131,806 (GRCm39) missense probably benign 0.13
R4842:Map1a UTSW 2 121,132,567 (GRCm39) missense probably damaging 1.00
R4933:Map1a UTSW 2 121,136,386 (GRCm39) missense probably damaging 1.00
R4978:Map1a UTSW 2 121,131,623 (GRCm39) missense probably benign 0.00
R4988:Map1a UTSW 2 121,133,531 (GRCm39) missense probably benign 0.34
R5026:Map1a UTSW 2 121,138,019 (GRCm39) missense possibly damaging 0.83
R5086:Map1a UTSW 2 121,134,985 (GRCm39) missense probably damaging 1.00
R5155:Map1a UTSW 2 121,132,867 (GRCm39) missense probably damaging 1.00
R5232:Map1a UTSW 2 121,132,466 (GRCm39) missense probably damaging 1.00
R5311:Map1a UTSW 2 121,132,868 (GRCm39) missense probably damaging 1.00
R5401:Map1a UTSW 2 121,130,153 (GRCm39) missense probably damaging 1.00
R5465:Map1a UTSW 2 121,136,506 (GRCm39) missense probably damaging 1.00
R5526:Map1a UTSW 2 121,136,143 (GRCm39) missense probably damaging 1.00
R5642:Map1a UTSW 2 121,136,524 (GRCm39) missense probably damaging 1.00
R5726:Map1a UTSW 2 121,135,546 (GRCm39) missense probably damaging 1.00
R5817:Map1a UTSW 2 121,129,391 (GRCm39) missense possibly damaging 0.81
R5855:Map1a UTSW 2 121,134,155 (GRCm39) missense possibly damaging 0.74
R5917:Map1a UTSW 2 121,135,697 (GRCm39) missense probably damaging 1.00
R5974:Map1a UTSW 2 121,134,857 (GRCm39) missense probably benign 0.20
R5987:Map1a UTSW 2 121,134,776 (GRCm39) missense possibly damaging 0.56
R6151:Map1a UTSW 2 121,120,304 (GRCm39) missense probably benign 0.12
R6406:Map1a UTSW 2 121,131,224 (GRCm39) missense probably damaging 1.00
R7014:Map1a UTSW 2 121,130,720 (GRCm39) missense probably damaging 1.00
R7099:Map1a UTSW 2 121,130,998 (GRCm39) missense probably benign 0.04
R7211:Map1a UTSW 2 121,135,124 (GRCm39) missense probably benign 0.02
R7230:Map1a UTSW 2 121,131,299 (GRCm39) missense probably damaging 1.00
R7305:Map1a UTSW 2 121,129,939 (GRCm39) missense probably damaging 1.00
R7382:Map1a UTSW 2 121,121,266 (GRCm39) missense probably damaging 1.00
R7524:Map1a UTSW 2 121,120,293 (GRCm39) missense probably damaging 1.00
R7699:Map1a UTSW 2 121,130,201 (GRCm39) missense probably damaging 1.00
R7767:Map1a UTSW 2 121,132,517 (GRCm39) missense probably damaging 1.00
R7883:Map1a UTSW 2 121,135,853 (GRCm39) missense probably damaging 1.00
R7896:Map1a UTSW 2 121,135,657 (GRCm39) missense probably benign 0.00
R7993:Map1a UTSW 2 121,135,057 (GRCm39) missense possibly damaging 0.84
R8270:Map1a UTSW 2 121,129,501 (GRCm39) missense probably damaging 0.99
R8365:Map1a UTSW 2 121,138,528 (GRCm39) missense probably damaging 1.00
R8428:Map1a UTSW 2 121,135,418 (GRCm39) missense probably benign 0.42
R8490:Map1a UTSW 2 121,135,045 (GRCm39) missense possibly damaging 0.93
R8678:Map1a UTSW 2 121,137,737 (GRCm39) missense probably damaging 1.00
R8798:Map1a UTSW 2 121,132,768 (GRCm39) missense probably benign 0.20
R8857:Map1a UTSW 2 121,138,098 (GRCm39) missense probably damaging 1.00
R8878:Map1a UTSW 2 121,138,125 (GRCm39) missense probably damaging 1.00
R8909:Map1a UTSW 2 121,129,391 (GRCm39) missense probably damaging 0.99
R8917:Map1a UTSW 2 121,131,791 (GRCm39) missense possibly damaging 0.93
R8947:Map1a UTSW 2 121,135,450 (GRCm39) missense probably benign 0.27
R9069:Map1a UTSW 2 121,134,145 (GRCm39) missense probably benign 0.15
R9198:Map1a UTSW 2 121,133,854 (GRCm39) missense probably benign 0.00
R9253:Map1a UTSW 2 121,132,823 (GRCm39) missense probably benign 0.00
R9290:Map1a UTSW 2 121,131,014 (GRCm39) missense probably damaging 1.00
R9300:Map1a UTSW 2 121,133,446 (GRCm39) missense probably damaging 1.00
R9589:Map1a UTSW 2 121,136,398 (GRCm39) missense probably damaging 1.00
R9680:Map1a UTSW 2 121,132,865 (GRCm39) missense probably damaging 1.00
R9792:Map1a UTSW 2 121,121,304 (GRCm39) critical splice donor site probably null
R9793:Map1a UTSW 2 121,121,304 (GRCm39) critical splice donor site probably null
R9795:Map1a UTSW 2 121,121,304 (GRCm39) critical splice donor site probably null
RF003:Map1a UTSW 2 121,136,777 (GRCm39) small insertion probably benign
RF007:Map1a UTSW 2 121,136,789 (GRCm39) small insertion probably benign
RF009:Map1a UTSW 2 121,136,782 (GRCm39) small insertion probably benign
RF010:Map1a UTSW 2 121,136,799 (GRCm39) small insertion probably benign
RF014:Map1a UTSW 2 121,136,776 (GRCm39) small insertion probably benign
RF017:Map1a UTSW 2 121,136,789 (GRCm39) small insertion probably benign
RF024:Map1a UTSW 2 121,136,788 (GRCm39) small insertion probably benign
RF025:Map1a UTSW 2 121,136,775 (GRCm39) small insertion probably benign
RF030:Map1a UTSW 2 121,136,798 (GRCm39) small insertion probably benign
RF030:Map1a UTSW 2 121,136,792 (GRCm39) small insertion probably benign
RF033:Map1a UTSW 2 121,136,780 (GRCm39) small insertion probably benign
RF034:Map1a UTSW 2 121,136,788 (GRCm39) small insertion probably benign
RF034:Map1a UTSW 2 121,136,785 (GRCm39) small insertion probably benign
RF035:Map1a UTSW 2 121,136,782 (GRCm39) small insertion probably benign
RF037:Map1a UTSW 2 121,136,775 (GRCm39) small insertion probably benign
RF039:Map1a UTSW 2 121,136,785 (GRCm39) small insertion probably benign
RF042:Map1a UTSW 2 121,136,768 (GRCm39) small insertion probably benign
RF044:Map1a UTSW 2 121,136,774 (GRCm39) small insertion probably benign
RF045:Map1a UTSW 2 121,136,774 (GRCm39) small insertion probably benign
RF052:Map1a UTSW 2 121,136,776 (GRCm39) small insertion probably benign
RF053:Map1a UTSW 2 121,136,771 (GRCm39) small insertion probably benign
RF060:Map1a UTSW 2 121,136,799 (GRCm39) small insertion probably benign
RF061:Map1a UTSW 2 121,136,768 (GRCm39) small insertion probably benign
Z1176:Map1a UTSW 2 121,133,719 (GRCm39) missense possibly damaging 0.95
Z1177:Map1a UTSW 2 121,135,760 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGAAGGGTCCTCTTCTGAG -3'
(R):5'- TCGTTCCCAAGCATGAAGG -3'

Sequencing Primer
(F):5'- CTTCTGAGGCTACCACGC -3'
(R):5'- TGTGGCTGTGGCAAACC -3'
Posted On 2019-12-04