Incidental Mutation 'RF051:Gm14399'
ID 605136
Institutional Source Beutler Lab
Gene Symbol Gm14399
Ensembl Gene ENSMUSG00000090093
Gene Name predicted gene 14399
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # RF051 (G1)
Quality Score 109.008
Status Not validated
Chromosome 2
Chromosomal Location 174971286-174983805 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 174972994 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 254 (Q254E)
Ref Sequence ENSEMBL: ENSMUSP00000104688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099029] [ENSMUST00000108929] [ENSMUST00000109059] [ENSMUST00000109060] [ENSMUST00000109062]
AlphaFold A2ARW8
Predicted Effect probably benign
Transcript: ENSMUST00000099029
SMART Domains Protein: ENSMUSP00000096627
Gene: ENSMUSG00000090093

DomainStartEndE-ValueType
KRAB 3 63 1.37e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108929
SMART Domains Protein: ENSMUSP00000104557
Gene: ENSMUSG00000090093

DomainStartEndE-ValueType
ZnF_C2H2 46 65 1.61e2 SMART
ZnF_C2H2 71 93 4.17e-3 SMART
ZnF_C2H2 99 121 3.83e-2 SMART
ZnF_C2H2 127 149 8.6e-5 SMART
ZnF_C2H2 155 177 1.69e-3 SMART
ZnF_C2H2 183 205 7.37e-4 SMART
ZnF_C2H2 211 233 4.94e-5 SMART
ZnF_C2H2 239 261 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109059
SMART Domains Protein: ENSMUSP00000104687
Gene: ENSMUSG00000090093

DomainStartEndE-ValueType
KRAB 4 64 1.37e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109060
AA Change: Q254E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104688
Gene: ENSMUSG00000090093
AA Change: Q254E

DomainStartEndE-ValueType
KRAB 4 66 1.84e-13 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 3.83e-2 SMART
ZnF_C2H2 159 181 8.6e-5 SMART
ZnF_C2H2 187 209 4.17e-3 SMART
ZnF_C2H2 215 237 6.08e-5 SMART
ZnF_C2H2 243 265 5.99e-4 SMART
ZnF_C2H2 271 293 8.02e-5 SMART
ZnF_C2H2 299 321 3.83e-2 SMART
ZnF_C2H2 327 349 5.14e-3 SMART
ZnF_C2H2 355 377 5.14e-3 SMART
ZnF_C2H2 383 405 9.08e-4 SMART
ZnF_C2H2 411 433 1.69e-3 SMART
ZnF_C2H2 439 461 7.37e-4 SMART
ZnF_C2H2 467 489 9.08e-4 SMART
ZnF_C2H2 495 517 2.57e-3 SMART
ZnF_C2H2 523 545 7.78e-3 SMART
ZnF_C2H2 551 573 4.94e-5 SMART
ZnF_C2H2 579 601 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109062
SMART Domains Protein: ENSMUSP00000104690
Gene: ENSMUSG00000090093

DomainStartEndE-ValueType
KRAB 4 66 1.27e-16 SMART
low complexity region 80 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 47,047,674 (GRCm39) probably benign Het
Gabre CTCCGG CTCCGGGTCCGG X: 71,313,655 (GRCm39) probably benign Het
Garin5a GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,149,947 (GRCm39) probably null Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 (GRCm39) probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 (GRCm39) probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,179,990 (GRCm39) probably benign Het
Kmt2c CCTTCT CCT 5: 25,518,477 (GRCm39) probably benign Het
Manbal CGATAGAAT C 2: 157,237,932 (GRCm39) probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Mei1 GC GCTGGCTGCC 15: 81,954,211 (GRCm39) probably null Het
Nalf2 GCCGCC GCCGCCACCGCC X: 98,864,968 (GRCm39) probably benign Het
Nbea TTTA T 3: 55,916,633 (GRCm39) probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,891,054 (GRCm39) probably benign Het
Or2b7 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,739,693 (GRCm39) probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,134,010 (GRCm39) probably benign Het
Plekhg2 GGTG GG 7: 28,061,777 (GRCm39) probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,756,788 (GRCm39) probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,608,388 (GRCm39) probably benign Het
Stard8 GAG GAGCAG X: 98,110,130 (GRCm39) probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,966,651 (GRCm39) probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,851,234 (GRCm39) probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,000,426 (GRCm39) probably benign Het
Other mutations in Gm14399
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Gm14399 APN 2 174,973,315 (GRCm39) nonsense probably null
R2185:Gm14399 UTSW 2 174,973,188 (GRCm39) missense probably damaging 1.00
R3711:Gm14399 UTSW 2 174,973,303 (GRCm39) nonsense probably null
R4907:Gm14399 UTSW 2 174,973,182 (GRCm39) intron probably benign
R5361:Gm14399 UTSW 2 174,973,371 (GRCm39) missense probably damaging 1.00
R7252:Gm14399 UTSW 2 174,974,991 (GRCm39) missense probably damaging 0.98
R7278:Gm14399 UTSW 2 174,972,252 (GRCm39) intron probably benign
R7289:Gm14399 UTSW 2 174,972,204 (GRCm39) missense unknown
R7946:Gm14399 UTSW 2 174,973,273 (GRCm39) missense probably damaging 1.00
R8390:Gm14399 UTSW 2 174,972,605 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAATACTGCAAAGGCTTTACCACA -3'
(R):5'- TGCAAGAAGCTGTCATCTCC -3'

Sequencing Primer
(F):5'- CGCTCATGTATGTGGAGATGAC -3'
(R):5'- GAAGCTGTCATCTCCGAATGC -3'
Posted On 2019-12-04