Incidental Mutation 'RF051:Il2'
ID 605137
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF051 (G1)
Quality Score 214.458
Status Not validated
Chromosome 3
Chromosomal Location 37174862-37180103 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GGG to GGGGCTTGAAGTGGG at 37179990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect probably benign
Transcript: ENSMUST00000029275
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720

DomainStartEndE-ValueType
IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 47,047,674 (GRCm39) probably benign Het
Gabre CTCCGG CTCCGGGTCCGG X: 71,313,655 (GRCm39) probably benign Het
Garin5a GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,149,947 (GRCm39) probably null Het
Gm14399 G C 2: 174,972,994 (GRCm39) Q254E probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 (GRCm39) probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 (GRCm39) probably benign Het
Kmt2c CCTTCT CCT 5: 25,518,477 (GRCm39) probably benign Het
Manbal CGATAGAAT C 2: 157,237,932 (GRCm39) probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Mei1 GC GCTGGCTGCC 15: 81,954,211 (GRCm39) probably null Het
Nalf2 GCCGCC GCCGCCACCGCC X: 98,864,968 (GRCm39) probably benign Het
Nbea TTTA T 3: 55,916,633 (GRCm39) probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,891,054 (GRCm39) probably benign Het
Or2b7 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,739,693 (GRCm39) probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,134,010 (GRCm39) probably benign Het
Plekhg2 GGTG GG 7: 28,061,777 (GRCm39) probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,756,788 (GRCm39) probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,608,388 (GRCm39) probably benign Het
Stard8 GAG GAGCAG X: 98,110,130 (GRCm39) probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,966,651 (GRCm39) probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,851,234 (GRCm39) probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,000,426 (GRCm39) probably benign Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37,177,156 (GRCm39) missense possibly damaging 0.64
IGL02047:Il2 APN 3 37,180,000 (GRCm39) missense probably benign 0.01
FR4304:Il2 UTSW 3 37,179,975 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,977 (GRCm39) unclassified probably benign
FR4976:Il2 UTSW 3 37,179,978 (GRCm39) unclassified probably benign
R8805:Il2 UTSW 3 37,177,282 (GRCm39) missense possibly damaging 0.78
R9287:Il2 UTSW 3 37,179,988 (GRCm39) missense probably damaging 0.99
RF001:Il2 UTSW 3 37,179,911 (GRCm39) unclassified probably benign
RF023:Il2 UTSW 3 37,179,969 (GRCm39) unclassified probably benign
RF029:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF036:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF038:Il2 UTSW 3 37,179,970 (GRCm39) nonsense probably null
RF039:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF041:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF043:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,966 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,970 (GRCm39) unclassified probably benign
RF061:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF064:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCAAGAAAGCTAAAGGTATTGC -3'
(R):5'- TGCCACACAGGTAGACTCTTTG -3'

Sequencing Primer
(F):5'- CCTATAGATGGGATGGCTGTGCAC -3'
(R):5'- GTAATATGTAAAACATCGTGACACCC -3'
Posted On 2019-12-04