Incidental Mutation 'RF051:Fam71e1'
ID605144
Institutional Source Beutler Lab
Gene Symbol Fam71e1
Ensembl Gene ENSMUSG00000051113
Gene Namefamily with sequence similarity 71, member E1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #RF051 (G1)
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location44496581-44501486 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GGGTCTGAGGGAGGA to GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA at 44500523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107927] [ENSMUST00000118515] [ENSMUST00000118808] [ENSMUST00000138328] [ENSMUST00000165208] [ENSMUST00000205359] [ENSMUST00000205422] [ENSMUST00000206398]
Predicted Effect probably benign
Transcript: ENSMUST00000107927
SMART Domains Protein: ENSMUSP00000103560
Gene: ENSMUSG00000051113

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
Pfam:DUF3699 91 160 5.6e-20 PFAM
coiled coil region 164 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118515
SMART Domains Protein: ENSMUSP00000113141
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
low complexity region 239 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118808
SMART Domains Protein: ENSMUSP00000113509
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
low complexity region 246 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138328
SMART Domains Protein: ENSMUSP00000116293
Gene: ENSMUSG00000008140

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165208
SMART Domains Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
IG 54 150 6.26e-5 SMART
PDB:2LHU|A 160 236 7e-9 PDB
low complexity region 237 252 N/A INTRINSIC
IG 258 337 5.21e-2 SMART
IG 347 430 1.2e-1 SMART
IG 440 526 2.72e-5 SMART
IG 546 631 1.68e-5 SMART
FN3 634 717 3.29e-11 SMART
FN3 732 815 1.23e-10 SMART
IG 842 925 6.07e-3 SMART
FN3 928 1010 2.08e-8 SMART
IGc2 1055 1122 6.91e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205359
Predicted Effect probably benign
Transcript: ENSMUST00000205422
Predicted Effect probably benign
Transcript: ENSMUST00000206398
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 46,736,748 probably benign Het
Gabre CTCCGG CTCCGGGTCCGG X: 72,270,049 probably benign Het
Gm14399 G C 2: 175,131,201 Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Mei1 GC GCTGGCTGCC 15: 82,070,010 probably null Het
Nbea TTTA T 3: 56,009,212 probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,941,054 probably benign Het
Olfr1535 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,555,523 probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Het
Plekhg2 GGTG GG 7: 28,362,352 probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,608,929 probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,630,988 probably benign Het
Stard8 GAG GAGCAG X: 99,066,524 probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,833,579 probably benign Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,362 probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,967,034 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,089,129 probably benign Het
Other mutations in Fam71e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1355:Fam71e1 UTSW 7 44496691 missense possibly damaging 0.82
R5308:Fam71e1 UTSW 7 44500182 missense probably damaging 1.00
R5568:Fam71e1 UTSW 7 44501004 missense probably damaging 0.99
R6038:Fam71e1 UTSW 7 44500295 missense probably damaging 1.00
R6038:Fam71e1 UTSW 7 44500295 missense probably damaging 1.00
R8136:Fam71e1 UTSW 7 44500280 missense probably damaging 0.99
RF002:Fam71e1 UTSW 7 44500520 nonsense probably null
RF003:Fam71e1 UTSW 7 44500527 frame shift probably null
RF013:Fam71e1 UTSW 7 44500520 frame shift probably null
RF015:Fam71e1 UTSW 7 44500522 frame shift probably null
RF017:Fam71e1 UTSW 7 44500525 frame shift probably null
RF017:Fam71e1 UTSW 7 44500531 frame shift probably null
RF020:Fam71e1 UTSW 7 44500535 frame shift probably null
RF034:Fam71e1 UTSW 7 44500523 frame shift probably null
RF038:Fam71e1 UTSW 7 44500522 frame shift probably null
RF040:Fam71e1 UTSW 7 44500521 frame shift probably null
RF040:Fam71e1 UTSW 7 44500531 frame shift probably null
RF045:Fam71e1 UTSW 7 44500532 frame shift probably null
RF047:Fam71e1 UTSW 7 44500529 frame shift probably null
RF047:Fam71e1 UTSW 7 44500536 frame shift probably null
RF050:Fam71e1 UTSW 7 44500521 frame shift probably null
RF055:Fam71e1 UTSW 7 44500533 nonsense probably null
RF056:Fam71e1 UTSW 7 44500527 frame shift probably null
RF057:Fam71e1 UTSW 7 44500532 frame shift probably null
RF060:Fam71e1 UTSW 7 44500525 frame shift probably null
RF060:Fam71e1 UTSW 7 44500533 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGCCTTCTACTTGCAACTG -3'
(R):5'- TGGGCTAACAATATCAGCCAC -3'

Sequencing Primer
(F):5'- CTTCACGCACGAGGACACTG -3'
(R):5'- CACAGTCCCTAGTCTGCTGCAG -3'
Posted On2019-12-04