Incidental Mutation 'RF051:Pde3b'
ID605145
Institutional Source Beutler Lab
Gene Symbol Pde3b
Ensembl Gene ENSMUSG00000030671
Gene Namephosphodiesterase 3B, cGMP-inhibited
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF051 (G1)
Quality Score214.458
Status Not validated
Chromosome7
Chromosomal Location114415281-114539251 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GGTGGTGGTG to GGTGGTGGTGGTG at 114534775 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032909]
Predicted Effect probably benign
Transcript: ENSMUST00000032909
SMART Domains Protein: ENSMUSP00000032909
Gene: ENSMUSG00000030671

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
transmembrane domain 73 90 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 171 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
HDc 710 927 7.52e-4 SMART
low complexity region 991 1023 N/A INTRINSIC
low complexity region 1048 1067 N/A INTRINSIC
low complexity region 1081 1096 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149455
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutants show abnormalities in glycerol and fatty acid levels, along with changes in adipocyte morphology and decreased body fat percentage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 46,736,748 probably benign Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Gabre CTCCGG CTCCGGGTCCGG X: 72,270,049 probably benign Het
Gm14399 G C 2: 175,131,201 Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Mei1 GC GCTGGCTGCC 15: 82,070,010 probably null Het
Nbea TTTA T 3: 56,009,212 probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,941,054 probably benign Het
Olfr1535 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,555,523 probably null Het
Plekhg2 GGTG GG 7: 28,362,352 probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,608,929 probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,630,988 probably benign Het
Stard8 GAG GAGCAG X: 99,066,524 probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,833,579 probably benign Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,362 probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,967,034 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,089,129 probably benign Het
Other mutations in Pde3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Pde3b APN 7 114518410 missense probably benign 0.00
IGL01637:Pde3b APN 7 114526901 nonsense probably null
IGL02004:Pde3b APN 7 114519617 missense possibly damaging 0.67
IGL02113:Pde3b APN 7 114526906 missense probably damaging 1.00
IGL02201:Pde3b APN 7 114534608 missense probably damaging 1.00
IGL02266:Pde3b APN 7 114526966 missense probably damaging 1.00
IGL02601:Pde3b APN 7 114523342 missense probably damaging 1.00
IGL02641:Pde3b APN 7 114530817 missense probably damaging 1.00
IGL02671:Pde3b APN 7 114523345 missense possibly damaging 0.77
IGL02691:Pde3b APN 7 114508085 splice site probably benign
IGL02719:Pde3b APN 7 114506248 missense probably damaging 1.00
IGL03092:Pde3b APN 7 114523348 missense probably damaging 1.00
FR4342:Pde3b UTSW 7 114534775 small insertion probably benign
R0208:Pde3b UTSW 7 114497981 missense probably benign 0.00
R1191:Pde3b UTSW 7 114519575 missense probably benign 0.01
R1514:Pde3b UTSW 7 114530766 missense probably damaging 0.98
R1612:Pde3b UTSW 7 114519556 nonsense probably null
R2081:Pde3b UTSW 7 114523422 missense probably benign
R2433:Pde3b UTSW 7 114526837 missense probably benign 0.30
R2508:Pde3b UTSW 7 114526857 nonsense probably null
R3842:Pde3b UTSW 7 114526867 missense probably damaging 1.00
R4082:Pde3b UTSW 7 114494588 missense probably benign 0.04
R4115:Pde3b UTSW 7 114521727 missense probably damaging 1.00
R4197:Pde3b UTSW 7 114530872 splice site probably benign
R4236:Pde3b UTSW 7 114521688 missense possibly damaging 0.62
R4355:Pde3b UTSW 7 114416287 missense probably benign
R4411:Pde3b UTSW 7 114534749 small deletion probably benign
R4430:Pde3b UTSW 7 114534670 missense probably damaging 1.00
R4901:Pde3b UTSW 7 114508190 missense probably damaging 0.99
R4969:Pde3b UTSW 7 114519612 missense possibly damaging 0.92
R5314:Pde3b UTSW 7 114494537 missense probably damaging 1.00
R5346:Pde3b UTSW 7 114506190 missense probably benign 0.00
R5706:Pde3b UTSW 7 114521692 missense probably damaging 1.00
R5844:Pde3b UTSW 7 114508871 missense probably benign 0.01
R6014:Pde3b UTSW 7 114416440 missense probably damaging 1.00
R6048:Pde3b UTSW 7 114508267 missense probably benign 0.00
R6190:Pde3b UTSW 7 114523032 splice site probably null
R7220:Pde3b UTSW 7 114536062 missense probably damaging 0.97
R7239:Pde3b UTSW 7 114416149 missense probably damaging 0.99
R7818:Pde3b UTSW 7 114491440 missense probably damaging 0.99
R7869:Pde3b UTSW 7 114494687 missense probably benign 0.03
R8443:Pde3b UTSW 7 114526894 missense probably damaging 0.99
R8516:Pde3b UTSW 7 114526849 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGAAGCAACCCTGGGTCTAC -3'
(R):5'- AGCCTGAACACTTAGGAGTTACTC -3'

Sequencing Primer
(F):5'- GAAGCAACCCTGGGTCTACCTATTAG -3'
(R):5'- CCTTCGGGATAGCATTGAAAATG -3'
Posted On2019-12-04