Incidental Mutation 'RF051:Nefh'
ID 605147
Institutional Source Beutler Lab
Gene Symbol Nefh
Ensembl Gene ENSMUSG00000020396
Gene Name neurofilament, heavy polypeptide
Synonyms NF200, NF-H, NEFH
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF051 (G1)
Quality Score 217.468
Status Not validated
Chromosome 11
Chromosomal Location 4888754-4898064 bp(-) (GRCm39)
Type of Mutation small insertion (6 aa in frame mutation)
DNA Base Change (assembly) TGGCC to TGGCCGCACCTGGGGCCTCGGCC at 4891054 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093369]
AlphaFold P19246
Predicted Effect probably benign
Transcript: ENSMUST00000093369
SMART Domains Protein: ENSMUSP00000091061
Gene: ENSMUSG00000020396

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
Filament 94 410 1.45e-109 SMART
low complexity region 470 515 N/A INTRINSIC
Pfam:DUF1388 519 545 1.8e-14 PFAM
Pfam:DUF1388 536 562 5.8e-15 PFAM
Pfam:DUF1388 542 569 2.7e-12 PFAM
Pfam:DUF1388 578 611 9.7e-10 PFAM
Pfam:DUF1388 602 629 4.9e-14 PFAM
Pfam:DUF1388 608 635 4.7e-14 PFAM
Pfam:DUF1388 626 653 1.4e-13 PFAM
Pfam:DUF1388 632 659 2.5e-13 PFAM
Pfam:DUF1388 656 683 4.4e-14 PFAM
Pfam:DUF1388 680 706 1.5e-12 PFAM
Pfam:DUF1388 700 730 5e-12 PFAM
Pfam:DUF1388 728 755 7.9e-14 PFAM
Pfam:DUF1388 752 779 4.7e-14 PFAM
Pfam:DUF1388 779 800 1.9e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 858 948 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
low complexity region 976 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased axon diameter and transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 47,047,674 (GRCm39) probably benign Het
Gabre CTCCGG CTCCGGGTCCGG X: 71,313,655 (GRCm39) probably benign Het
Garin5a GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,149,947 (GRCm39) probably null Het
Gm14399 G C 2: 174,972,994 (GRCm39) Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 (GRCm39) probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 (GRCm39) probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,179,990 (GRCm39) probably benign Het
Kmt2c CCTTCT CCT 5: 25,518,477 (GRCm39) probably benign Het
Manbal CGATAGAAT C 2: 157,237,932 (GRCm39) probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Mei1 GC GCTGGCTGCC 15: 81,954,211 (GRCm39) probably null Het
Nalf2 GCCGCC GCCGCCACCGCC X: 98,864,968 (GRCm39) probably benign Het
Nbea TTTA T 3: 55,916,633 (GRCm39) probably benign Het
Or2b7 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,739,693 (GRCm39) probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,134,010 (GRCm39) probably benign Het
Plekhg2 GGTG GG 7: 28,061,777 (GRCm39) probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,756,788 (GRCm39) probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,608,388 (GRCm39) probably benign Het
Stard8 GAG GAGCAG X: 98,110,130 (GRCm39) probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,966,651 (GRCm39) probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,851,234 (GRCm39) probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,000,426 (GRCm39) probably benign Het
Other mutations in Nefh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Nefh APN 11 4,891,356 (GRCm39) missense possibly damaging 0.71
IGL03025:Nefh APN 11 4,895,289 (GRCm39) missense probably damaging 0.99
FR4340:Nefh UTSW 11 4,891,040 (GRCm39) small insertion probably benign
FR4340:Nefh UTSW 11 4,891,038 (GRCm39) small insertion probably benign
FR4340:Nefh UTSW 11 4,891,033 (GRCm39) small insertion probably benign
R0041:Nefh UTSW 11 4,895,184 (GRCm39) missense possibly damaging 0.92
R0149:Nefh UTSW 11 4,890,799 (GRCm39) missense probably benign 0.39
R0361:Nefh UTSW 11 4,890,799 (GRCm39) missense probably benign 0.39
R0531:Nefh UTSW 11 4,890,240 (GRCm39) missense probably damaging 1.00
R1340:Nefh UTSW 11 4,891,002 (GRCm39) small insertion probably benign
R1349:Nefh UTSW 11 4,891,010 (GRCm39) small insertion probably benign
R1469:Nefh UTSW 11 4,890,066 (GRCm39) missense probably benign 0.20
R1469:Nefh UTSW 11 4,890,066 (GRCm39) missense probably benign 0.20
R1564:Nefh UTSW 11 4,889,878 (GRCm39) missense unknown
R2165:Nefh UTSW 11 4,893,872 (GRCm39) missense probably damaging 1.00
R2417:Nefh UTSW 11 4,889,479 (GRCm39) missense unknown
R2906:Nefh UTSW 11 4,890,216 (GRCm39) missense probably benign 0.15
R3750:Nefh UTSW 11 4,889,937 (GRCm39) missense probably benign 0.33
R4298:Nefh UTSW 11 4,890,066 (GRCm39) missense probably benign
R4462:Nefh UTSW 11 4,891,015 (GRCm39) missense probably damaging 0.98
R4713:Nefh UTSW 11 4,889,656 (GRCm39) missense unknown
R4878:Nefh UTSW 11 4,891,333 (GRCm39) missense probably damaging 0.98
R5423:Nefh UTSW 11 4,890,985 (GRCm39) missense possibly damaging 0.59
R5648:Nefh UTSW 11 4,895,233 (GRCm39) missense probably damaging 1.00
R5893:Nefh UTSW 11 4,891,323 (GRCm39) missense probably damaging 1.00
R6459:Nefh UTSW 11 4,889,551 (GRCm39) missense unknown
R7583:Nefh UTSW 11 4,891,089 (GRCm39) missense probably damaging 0.96
R8557:Nefh UTSW 11 4,891,233 (GRCm39) missense probably damaging 0.98
R8925:Nefh UTSW 11 4,890,530 (GRCm39) small deletion probably benign
R8982:Nefh UTSW 11 4,897,549 (GRCm39) missense probably damaging 1.00
R9101:Nefh UTSW 11 4,890,925 (GRCm39) missense probably damaging 0.97
R9291:Nefh UTSW 11 4,890,871 (GRCm39) missense probably benign 0.39
R9576:Nefh UTSW 11 4,891,222 (GRCm39) missense possibly damaging 0.91
R9616:Nefh UTSW 11 4,889,443 (GRCm39) nonsense probably null
R9709:Nefh UTSW 11 4,890,042 (GRCm39) missense probably benign 0.44
R9781:Nefh UTSW 11 4,895,271 (GRCm39) missense probably damaging 1.00
RF001:Nefh UTSW 11 4,891,030 (GRCm39) small insertion probably benign
RF002:Nefh UTSW 11 4,891,050 (GRCm39) small insertion probably benign
RF002:Nefh UTSW 11 4,891,047 (GRCm39) small insertion probably benign
RF009:Nefh UTSW 11 4,890,997 (GRCm39) small insertion probably benign
RF012:Nefh UTSW 11 4,891,055 (GRCm39) small insertion probably benign
RF012:Nefh UTSW 11 4,891,030 (GRCm39) small insertion probably benign
RF012:Nefh UTSW 11 4,891,032 (GRCm39) small insertion probably benign
RF013:Nefh UTSW 11 4,891,032 (GRCm39) small insertion probably benign
RF016:Nefh UTSW 11 4,891,023 (GRCm39) small insertion probably benign
RF016:Nefh UTSW 11 4,891,022 (GRCm39) small insertion probably benign
RF025:Nefh UTSW 11 4,891,029 (GRCm39) small insertion probably benign
RF025:Nefh UTSW 11 4,891,003 (GRCm39) small insertion probably benign
RF028:Nefh UTSW 11 4,891,029 (GRCm39) small insertion probably benign
RF028:Nefh UTSW 11 4,891,012 (GRCm39) small insertion probably benign
RF033:Nefh UTSW 11 4,891,029 (GRCm39) frame shift probably null
RF033:Nefh UTSW 11 4,891,039 (GRCm39) small insertion probably benign
RF035:Nefh UTSW 11 4,891,039 (GRCm39) small insertion probably benign
RF036:Nefh UTSW 11 4,891,048 (GRCm39) small insertion probably benign
RF036:Nefh UTSW 11 4,891,036 (GRCm39) small insertion probably benign
RF036:Nefh UTSW 11 4,891,016 (GRCm39) small insertion probably benign
RF036:Nefh UTSW 11 4,891,010 (GRCm39) small insertion probably benign
RF037:Nefh UTSW 11 4,891,054 (GRCm39) small insertion probably benign
RF037:Nefh UTSW 11 4,891,046 (GRCm39) small insertion probably benign
RF037:Nefh UTSW 11 4,890,999 (GRCm39) small insertion probably benign
RF038:Nefh UTSW 11 4,891,019 (GRCm39) small insertion probably benign
RF038:Nefh UTSW 11 4,891,018 (GRCm39) small insertion probably benign
RF038:Nefh UTSW 11 4,891,012 (GRCm39) small insertion probably benign
RF038:Nefh UTSW 11 4,891,040 (GRCm39) small insertion probably benign
RF038:Nefh UTSW 11 4,891,029 (GRCm39) small insertion probably benign
RF038:Nefh UTSW 11 4,891,027 (GRCm39) small insertion probably benign
RF039:Nefh UTSW 11 4,891,007 (GRCm39) small insertion probably benign
RF041:Nefh UTSW 11 4,891,039 (GRCm39) small insertion probably benign
RF043:Nefh UTSW 11 4,891,016 (GRCm39) small insertion probably benign
RF044:Nefh UTSW 11 4,891,023 (GRCm39) small insertion probably benign
RF044:Nefh UTSW 11 4,891,021 (GRCm39) small insertion probably benign
RF044:Nefh UTSW 11 4,891,016 (GRCm39) small insertion probably benign
RF047:Nefh UTSW 11 4,891,038 (GRCm39) small insertion probably benign
RF048:Nefh UTSW 11 4,891,007 (GRCm39) small insertion probably benign
RF048:Nefh UTSW 11 4,891,003 (GRCm39) small insertion probably benign
RF049:Nefh UTSW 11 4,890,997 (GRCm39) small insertion probably benign
RF053:Nefh UTSW 11 4,891,014 (GRCm39) nonsense probably null
RF054:Nefh UTSW 11 4,891,048 (GRCm39) small insertion probably benign
RF055:Nefh UTSW 11 4,891,004 (GRCm39) small insertion probably benign
RF058:Nefh UTSW 11 4,891,021 (GRCm39) small insertion probably benign
RF060:Nefh UTSW 11 4,891,052 (GRCm39) small insertion probably benign
RF060:Nefh UTSW 11 4,891,050 (GRCm39) small insertion probably benign
RF062:Nefh UTSW 11 4,891,028 (GRCm39) small insertion probably benign
T0975:Nefh UTSW 11 4,890,151 (GRCm39) missense probably benign 0.00
Z1186:Nefh UTSW 11 4,890,530 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACTGTAGCTGGAGACTTGGG -3'
(R):5'- ATTGGCTTTGGTCCGAGTCC -3'

Sequencing Primer
(F):5'- ACTTGGGCTCAGCTGGTGAC -3'
(R):5'- TCTTACTGAAGGACTCCCAAAAATTC -3'
Posted On 2019-12-04