Incidental Mutation 'RF051:Olfr1535'
ID605148
Institutional Source Beutler Lab
Gene Symbol Olfr1535
Ensembl Gene ENSMUSG00000054890
Gene Nameolfactory receptor 1535
SynonymsMOR256-36, Olfr1365, MOR256-63, GA_x6K02T2QHY8-11688984-11689964, MOR256-36
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #RF051 (G1)
Quality Score217.468
Status Not validated
Chromosome13
Chromosomal Location21553894-21559893 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT to GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT at 21555523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068163] [ENSMUST00000217519]
Predicted Effect probably null
Transcript: ENSMUST00000068163
SMART Domains Protein: ENSMUSP00000064142
Gene: ENSMUSG00000054890

DomainStartEndE-ValueType
Pfam:7tm_4 31 320 5.4e-46 PFAM
Pfam:7tm_1 41 302 1.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217519
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 46,736,748 probably benign Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Gabre CTCCGG CTCCGGGTCCGG X: 72,270,049 probably benign Het
Gm14399 G C 2: 175,131,201 Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Mei1 GC GCTGGCTGCC 15: 82,070,010 probably null Het
Nbea TTTA T 3: 56,009,212 probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,941,054 probably benign Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Het
Plekhg2 GGTG GG 7: 28,362,352 probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,608,929 probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,630,988 probably benign Het
Stard8 GAG GAGCAG X: 99,066,524 probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,833,579 probably benign Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,362 probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,967,034 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,089,129 probably benign Het
Other mutations in Olfr1535
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Olfr1535 APN 13 21555219 missense probably damaging 0.98
IGL01866:Olfr1535 APN 13 21555173 missense probably benign 0.07
IGL02289:Olfr1535 APN 13 21555588 missense probably benign 0.02
IGL02350:Olfr1535 APN 13 21555602 missense probably damaging 1.00
IGL02357:Olfr1535 APN 13 21555602 missense probably damaging 1.00
IGL02793:Olfr1535 APN 13 21556002 missense probably damaging 1.00
IGL02875:Olfr1535 APN 13 21556002 missense probably damaging 1.00
R0785:Olfr1535 UTSW 13 21555788 missense probably benign 0.02
R1773:Olfr1535 UTSW 13 21555812 missense probably damaging 1.00
R3429:Olfr1535 UTSW 13 21555805 nonsense probably null
R3430:Olfr1535 UTSW 13 21555805 nonsense probably null
R4232:Olfr1535 UTSW 13 21555461 missense probably damaging 0.98
R4883:Olfr1535 UTSW 13 21555488 missense probably benign 0.22
R5586:Olfr1535 UTSW 13 21555096 missense probably damaging 1.00
R6032:Olfr1535 UTSW 13 21555907 missense probably benign 0.01
R6032:Olfr1535 UTSW 13 21555907 missense probably benign 0.01
R6542:Olfr1535 UTSW 13 21555507 missense probably damaging 0.99
R7014:Olfr1535 UTSW 13 21555938 missense probably benign 0.02
R7579:Olfr1535 UTSW 13 21556006 missense probably benign 0.08
R7598:Olfr1535 UTSW 13 21555188 missense probably damaging 1.00
R7982:Olfr1535 UTSW 13 21555966 missense probably benign
R8239:Olfr1535 UTSW 13 21555618 missense probably benign 0.01
R8339:Olfr1535 UTSW 13 21555826 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATGAGTAATGTAGCCATAGGAC -3'
(R):5'- CTTCATTGCCCTGGGACTTG -3'

Sequencing Primer
(F):5'- TGTAGCCATAGGACACTAATATGAG -3'
(R):5'- ACTTGGGGGAGTAGAGTGTATAC -3'
Posted On2019-12-04