Incidental Mutation 'RF051:Mei1'
ID605150
Institutional Source Beutler Lab
Gene Symbol Mei1
Ensembl Gene ENSMUSG00000068117
Gene Namemeiotic double-stranded break formation protein 1
Synonymsmei1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #RF051 (G1)
Quality Score160.492
Status Not validated
Chromosome15
Chromosomal Location82069996-82126814 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GC to GCTGGCTGCC at 82070010 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089178] [ENSMUST00000100396] [ENSMUST00000229119]
Predicted Effect probably benign
Transcript: ENSMUST00000089178
SMART Domains Protein: ENSMUSP00000086582
Gene: ENSMUSG00000068117

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
SCOP:d1gw5a_ 123 498 1e-3 SMART
low complexity region 956 966 N/A INTRINSIC
low complexity region 1025 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100396
SMART Domains Protein: ENSMUSP00000097965
Gene: ENSMUSG00000075524

DomainStartEndE-ValueType
Pfam:DUF4727 25 234 1.1e-109 PFAM
internal_repeat_1 321 406 9.89e-8 PROSPERO
low complexity region 453 465 N/A INTRINSIC
internal_repeat_2 593 707 6.03e-6 PROSPERO
low complexity region 735 752 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
internal_repeat_2 842 958 6.03e-6 PROSPERO
internal_repeat_1 876 962 9.89e-8 PROSPERO
low complexity region 985 996 N/A INTRINSIC
low complexity region 1117 1133 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1199 1208 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1282 1296 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000229119
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice of both sexes exhibit meiotic defects and are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 46,736,748 probably benign Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Gabre CTCCGG CTCCGGGTCCGG X: 72,270,049 probably benign Het
Gm14399 G C 2: 175,131,201 Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Nbea TTTA T 3: 56,009,212 probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,941,054 probably benign Het
Olfr1535 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,555,523 probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Het
Plekhg2 GGTG GG 7: 28,362,352 probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,608,929 probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,630,988 probably benign Het
Stard8 GAG GAGCAG X: 99,066,524 probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,833,579 probably benign Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,362 probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,967,034 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,089,129 probably benign Het
Other mutations in Mei1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Mei1 APN 15 82089552 missense probably damaging 0.99
IGL01776:Mei1 APN 15 82095932 critical splice donor site probably null
IGL01864:Mei1 APN 15 82113017 splice site probably benign
IGL02030:Mei1 APN 15 82115743 missense probably benign
IGL02148:Mei1 APN 15 82092711 nonsense probably null
R0135:Mei1 UTSW 15 82071969 nonsense probably null
R0212:Mei1 UTSW 15 82095931 critical splice donor site probably null
R0537:Mei1 UTSW 15 82091361 missense possibly damaging 0.93
R0605:Mei1 UTSW 15 82070150 missense probably benign
R0727:Mei1 UTSW 15 82070149 missense probably benign 0.01
R1118:Mei1 UTSW 15 82115867 splice site probably benign
R1226:Mei1 UTSW 15 82080084 missense possibly damaging 0.92
R1339:Mei1 UTSW 15 82081995 missense possibly damaging 0.66
R1558:Mei1 UTSW 15 82107133 missense probably damaging 1.00
R1769:Mei1 UTSW 15 82112570 splice site probably null
R1868:Mei1 UTSW 15 82124953 missense probably damaging 1.00
R1980:Mei1 UTSW 15 82103312 missense probably benign 0.00
R1981:Mei1 UTSW 15 82103312 missense probably benign 0.00
R1982:Mei1 UTSW 15 82103312 missense probably benign 0.00
R2103:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R2103:Mei1 UTSW 15 82107036 missense probably damaging 0.99
R2207:Mei1 UTSW 15 82103249 missense probably benign 0.08
R2444:Mei1 UTSW 15 82112941 missense probably damaging 1.00
R3009:Mei1 UTSW 15 82112525 missense probably damaging 0.97
R3114:Mei1 UTSW 15 82124959 missense probably benign 0.31
R3546:Mei1 UTSW 15 82098042 missense probably damaging 0.97
R3720:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3721:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3722:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3752:Mei1 UTSW 15 82086182 missense probably damaging 0.97
R3778:Mei1 UTSW 15 82082008 missense probably damaging 1.00
R3848:Mei1 UTSW 15 82113017 splice site probably benign
R3933:Mei1 UTSW 15 82083152 missense possibly damaging 0.75
R4274:Mei1 UTSW 15 82124863 missense possibly damaging 0.66
R4765:Mei1 UTSW 15 82112485 missense possibly damaging 0.96
R5070:Mei1 UTSW 15 82077603 missense possibly damaging 0.66
R5394:Mei1 UTSW 15 82092756 missense possibly damaging 0.83
R6108:Mei1 UTSW 15 82075188 missense possibly damaging 0.66
R6302:Mei1 UTSW 15 82103238 nonsense probably null
R6849:Mei1 UTSW 15 82079945 missense possibly damaging 0.92
R6913:Mei1 UTSW 15 82089609 missense probably benign 0.06
R6919:Mei1 UTSW 15 82081930 missense probably damaging 0.98
R6959:Mei1 UTSW 15 82124875 missense probably benign 0.01
R7007:Mei1 UTSW 15 82093999 missense probably damaging 0.99
R7202:Mei1 UTSW 15 82092642 missense
R7374:Mei1 UTSW 15 82095908 missense
R7438:Mei1 UTSW 15 82115481 missense
R7757:Mei1 UTSW 15 82082623 intron probably benign
R7857:Mei1 UTSW 15 82092717 missense not run
R8265:Mei1 UTSW 15 82103307 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAGCAGTCCTGTCTCAGTC -3'
(R):5'- CATCTCTCCCAAACGCGG -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- CCAAACGCGGGATGGTCAG -3'
Posted On2019-12-04