Incidental Mutation 'RF051:Cnpy3'
ID605151
Institutional Source Beutler Lab
Gene Symbol Cnpy3
Ensembl Gene ENSMUSG00000023973
Gene Namecanopy FGF signaling regulator 3
SynonymsTnrc5, 1600025D17Rik, ERDA5, CAG4A, 2410050O22Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF051 (G1)
Quality Score185.468
Status Not validated
Chromosome17
Chromosomal Location46735705-46752214 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) CTC to CTCATC at 46736748 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059844] [ENSMUST00000129200]
Predicted Effect probably benign
Transcript: ENSMUST00000059844
SMART Domains Protein: ENSMUSP00000050309
Gene: ENSMUSG00000023973

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:DUF3456 48 206 5.5e-51 PFAM
low complexity region 222 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129200
SMART Domains Protein: ENSMUSP00000120790
Gene: ENSMUSG00000023973

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the canopy family of proteins. The encoded protein may play a role in the maturation of toll-like receptors. Homozygous knockout mice for this gene show reduced cell surface expression of toll-like receptors and an impaired immune response including reduced production of cytokines in a mouse model of sepsis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal growth retardation, postnatal lethality and defects in immune responses mediated by Toll-like receptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Gabre CTCCGG CTCCGGGTCCGG X: 72,270,049 probably benign Het
Gm14399 G C 2: 175,131,201 Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Mei1 GC GCTGGCTGCC 15: 82,070,010 probably null Het
Nbea TTTA T 3: 56,009,212 probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,941,054 probably benign Het
Olfr1535 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,555,523 probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Het
Plekhg2 GGTG GG 7: 28,362,352 probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,608,929 probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,630,988 probably benign Het
Stard8 GAG GAGCAG X: 99,066,524 probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,833,579 probably benign Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,362 probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,967,034 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,089,129 probably benign Het
Other mutations in Cnpy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Cnpy3 APN 17 46743291 intron probably benign
FR4304:Cnpy3 UTSW 17 46736743 utr 3 prime probably benign
FR4304:Cnpy3 UTSW 17 46736746 utr 3 prime probably benign
FR4589:Cnpy3 UTSW 17 46736739 utr 3 prime probably benign
FR4976:Cnpy3 UTSW 17 46736747 nonsense probably null
LCD18:Cnpy3 UTSW 17 46737536 intron probably benign
R2357:Cnpy3 UTSW 17 46751983 missense probably damaging 0.99
R3151:Cnpy3 UTSW 17 46747526 missense probably damaging 1.00
R4429:Cnpy3 UTSW 17 46747144 missense probably benign 0.00
R4713:Cnpy3 UTSW 17 46747465 nonsense probably null
R6006:Cnpy3 UTSW 17 46736864 missense probably benign 0.00
R7766:Cnpy3 UTSW 17 46737235 missense possibly damaging 0.80
RF013:Cnpy3 UTSW 17 46736744 utr 3 prime probably benign
RF052:Cnpy3 UTSW 17 46736748 utr 3 prime probably benign
RF056:Cnpy3 UTSW 17 46736744 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCTCTTGCTGTTGTTCAAGG -3'
(R):5'- AGATGGGTTGAAGGCTGCTC -3'

Sequencing Primer
(F):5'- TTGCTGTTGTTCAAGGGAAGGAAAG -3'
(R):5'- TTGAAGGCTGCTCCCCTAAG -3'
Posted On2019-12-04