Incidental Mutation 'RF051:Cnpy3'
ID 605151
Institutional Source Beutler Lab
Gene Symbol Cnpy3
Ensembl Gene ENSMUSG00000023973
Gene Name canopy FGF signaling regulator 3
Synonyms ERDA5, 2410050O22Rik, Tnrc5, 1600025D17Rik, CAG4A
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF051 (G1)
Quality Score 185.468
Status Not validated
Chromosome 17
Chromosomal Location 47046631-47063140 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) CTC to CTCATC at 47047674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059844] [ENSMUST00000129200]
AlphaFold Q9DAU1
Predicted Effect probably benign
Transcript: ENSMUST00000059844
SMART Domains Protein: ENSMUSP00000050309
Gene: ENSMUSG00000023973

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:DUF3456 48 206 5.5e-51 PFAM
low complexity region 222 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129200
SMART Domains Protein: ENSMUSP00000120790
Gene: ENSMUSG00000023973

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the canopy family of proteins. The encoded protein may play a role in the maturation of toll-like receptors. Homozygous knockout mice for this gene show reduced cell surface expression of toll-like receptors and an impaired immune response including reduced production of cytokines in a mouse model of sepsis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal growth retardation, postnatal lethality and defects in immune responses mediated by Toll-like receptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Gabre CTCCGG CTCCGGGTCCGG X: 71,313,655 (GRCm39) probably benign Het
Garin5a GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,149,947 (GRCm39) probably null Het
Gm14399 G C 2: 174,972,994 (GRCm39) Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 (GRCm39) probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 (GRCm39) probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,179,990 (GRCm39) probably benign Het
Kmt2c CCTTCT CCT 5: 25,518,477 (GRCm39) probably benign Het
Manbal CGATAGAAT C 2: 157,237,932 (GRCm39) probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Mei1 GC GCTGGCTGCC 15: 81,954,211 (GRCm39) probably null Het
Nalf2 GCCGCC GCCGCCACCGCC X: 98,864,968 (GRCm39) probably benign Het
Nbea TTTA T 3: 55,916,633 (GRCm39) probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,891,054 (GRCm39) probably benign Het
Or2b7 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,739,693 (GRCm39) probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,134,010 (GRCm39) probably benign Het
Plekhg2 GGTG GG 7: 28,061,777 (GRCm39) probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,756,788 (GRCm39) probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,608,388 (GRCm39) probably benign Het
Stard8 GAG GAGCAG X: 98,110,130 (GRCm39) probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,966,651 (GRCm39) probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,851,234 (GRCm39) probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,000,426 (GRCm39) probably benign Het
Other mutations in Cnpy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Cnpy3 APN 17 47,054,217 (GRCm39) intron probably benign
FR4304:Cnpy3 UTSW 17 47,047,672 (GRCm39) utr 3 prime probably benign
FR4304:Cnpy3 UTSW 17 47,047,669 (GRCm39) utr 3 prime probably benign
FR4589:Cnpy3 UTSW 17 47,047,665 (GRCm39) utr 3 prime probably benign
FR4976:Cnpy3 UTSW 17 47,047,673 (GRCm39) nonsense probably null
LCD18:Cnpy3 UTSW 17 47,048,462 (GRCm39) intron probably benign
R2357:Cnpy3 UTSW 17 47,062,909 (GRCm39) missense probably damaging 0.99
R3151:Cnpy3 UTSW 17 47,058,452 (GRCm39) missense probably damaging 1.00
R4429:Cnpy3 UTSW 17 47,058,070 (GRCm39) missense probably benign 0.00
R4713:Cnpy3 UTSW 17 47,058,391 (GRCm39) nonsense probably null
R6006:Cnpy3 UTSW 17 47,047,790 (GRCm39) missense probably benign 0.00
R7766:Cnpy3 UTSW 17 47,048,161 (GRCm39) missense possibly damaging 0.80
R8875:Cnpy3 UTSW 17 47,048,185 (GRCm39) missense probably damaging 1.00
R9168:Cnpy3 UTSW 17 47,063,019 (GRCm39) missense unknown
RF013:Cnpy3 UTSW 17 47,047,670 (GRCm39) utr 3 prime probably benign
RF052:Cnpy3 UTSW 17 47,047,674 (GRCm39) utr 3 prime probably benign
RF056:Cnpy3 UTSW 17 47,047,670 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCTCTTGCTGTTGTTCAAGG -3'
(R):5'- AGATGGGTTGAAGGCTGCTC -3'

Sequencing Primer
(F):5'- TTGCTGTTGTTCAAGGGAAGGAAAG -3'
(R):5'- TTGAAGGCTGCTCCCCTAAG -3'
Posted On 2019-12-04