Mutagenetix > Incidental Mutation

Incidental Mutation 'RF051:Smarca2'

605153

Institutional Source

Beutler Lab

Gene Symbol

Smarca2

Ensembl Gene

ENSMUSG00000024921

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

Synonyms

Snf2l2, brm, 2610209L14Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

RF051 (G1)

Quality Score

180.502

Status

Not validated

Chromosome

Chromosomal Location

26582578-26755721 bp(+) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

AGCAGC to AGCAGCCGCAGC at 26608388 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176584] [ENSMUST00000176769] [ENSMUST00000208163]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000025862

SMART Domains

Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1501	3.13e-41	SMART
low complexity region	1502	1524	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1564	1576	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099537

SMART Domains

Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	7e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
PDB:2DAT\|A	1389	1410	1e-6	PDB
low complexity region	1480	1508	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176030

SMART Domains

Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1519	1.74e-39	SMART
low complexity region	1520	1542	N/A	INTRINSIC
low complexity region	1544	1558	N/A	INTRINSIC
low complexity region	1582	1594	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176584

SMART Domains

Protein: ENSMUSP00000135344
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
low complexity region	22	37	N/A	INTRINSIC
low complexity region	59	78	N/A	INTRINSIC
QLQ	96	132	2.58e-13	SMART
low complexity region	140	172	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176769

SMART Domains

Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	908	4.18e-24	SMART
low complexity region	947	956	N/A	INTRINSIC
HELICc	1033	1117	3.84e-23	SMART
low complexity region	1175	1190	N/A	INTRINSIC
SnAC	1211	1279	7.29e-28	SMART
low complexity region	1286	1308	N/A	INTRINSIC
BROMO	1333	1443	3.13e-41	SMART
low complexity region	1444	1466	N/A	INTRINSIC
low complexity region	1468	1482	N/A	INTRINSIC
low complexity region	1506	1518	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208163

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.4%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cnpy3	CTC	CTCATC	17: 47,047,674 (GRCm39)		probably benign	Het
Gabre	CTCCGG	CTCCGGGTCCGG	X: 71,313,655 (GRCm39)		probably benign	Het
Garin5a	GGGTCTGAGGGAGGA	GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA	7: 44,149,947 (GRCm39)		probably null	Het
Gm14399	G	C	2: 174,972,994 (GRCm39)	Q254E	probably benign	Het
Hsdl2	TGC	TGCCGGAGCAGCCACAGCGGC	4: 59,610,636 (GRCm39)		probably benign	Het
Hsdl2	CAGCTGCAG	CAGCTGCAGCAGCAGCCAAAGCTGCAG	4: 59,610,650 (GRCm39)		probably benign	Het
Il2	GGG	GGGGCTTGAAGTGGG	3: 37,179,990 (GRCm39)		probably benign	Het
Kmt2c	CCTTCT	CCT	5: 25,518,477 (GRCm39)		probably benign	Het
Manbal	CGATAGAAT	C	2: 157,237,932 (GRCm39)		probably null	Het
Map1a	CTCCAGCTCCAGCTCCAGCTCCA	CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA	2: 121,136,777 (GRCm39)		probably benign	Het
Mei1	GC	GCTGGCTGCC	15: 81,954,211 (GRCm39)		probably null	Het
Nalf2	GCCGCC	GCCGCCACCGCC	X: 98,864,968 (GRCm39)		probably benign	Het
Nbea	TTTA	T	3: 55,916,633 (GRCm39)		probably benign	Het
Nefh	TGGCC	TGGCCGCACCTGGGGCCTCGGCC	11: 4,891,054 (GRCm39)		probably benign	Het
Or2b7	GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT	GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT	13: 21,739,693 (GRCm39)		probably null	Het
Pde3b	GGTGGTGGTG	GGTGGTGGTGGTG	7: 114,134,010 (GRCm39)		probably benign	Het
Plekhg2	GGTG	GG	7: 28,061,777 (GRCm39)		probably null	Het
Rassf6	AGCAATGGGGA	AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA	5: 90,756,788 (GRCm39)		probably benign	Het
Stard8	GAG	GAGCAG	X: 98,110,130 (GRCm39)		probably benign	Het
Tcof1	CTTGGC	CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC	18: 60,966,651 (GRCm39)		probably benign	Het
Triobp	AGCCCCAGGACTCCCTGTGCCCAACGG	AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG	15: 78,851,234 (GRCm39)		probably benign	Het
Usp2	C	CTCATGTGACCTGTTCTTCACTTCT	9: 44,000,426 (GRCm39)		probably benign	Het

Other mutations in Smarca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01368:Smarca2	APN	19	26,751,694 (GRCm39)	missense	possibly damaging	0.82
IGL01907:Smarca2	APN	19	26,675,865 (GRCm39)	missense	possibly damaging	0.59
IGL02039:Smarca2	APN	19	26,693,537 (GRCm39)	missense	probably damaging	1.00
IGL02110:Smarca2	APN	19	26,650,140 (GRCm39)	missense	possibly damaging	0.96
IGL02561:Smarca2	APN	19	26,693,582 (GRCm39)	missense	possibly damaging	0.92
IGL02649:Smarca2	APN	19	26,617,986 (GRCm39)	missense	possibly damaging	0.73
IGL02880:Smarca2	APN	19	26,654,024 (GRCm39)	splice site	probably benign
IGL03028:Smarca2	APN	19	26,655,712 (GRCm39)	splice site	probably benign
IGL03187:Smarca2	APN	19	26,650,224 (GRCm39)	missense	probably damaging	0.98
IGL03213:Smarca2	APN	19	26,601,375 (GRCm39)	missense	probably damaging	1.00
IGL03354:Smarca2	APN	19	26,597,303 (GRCm39)	missense	probably benign	0.01
Genghis	UTSW	19	26,597,284 (GRCm39)	missense	possibly damaging	0.53
kraft	UTSW	19	26,655,763 (GRCm39)	missense	probably damaging	0.99
Kublai	UTSW	19	26,618,013 (GRCm39)	missense	probably damaging	1.00
Samarkand	UTSW	19	26,631,864 (GRCm39)	nonsense	probably null
tashkent	UTSW	19	26,698,273 (GRCm39)	missense	probably benign	0.06
Xanadu	UTSW	19	26,659,452 (GRCm39)	missense	possibly damaging	0.52
FR4737:Smarca2	UTSW	19	26,608,399 (GRCm39)	unclassified	probably benign
PIT1430001:Smarca2	UTSW	19	26,626,493 (GRCm39)	missense	probably benign	0.35
R0184:Smarca2	UTSW	19	26,669,649 (GRCm39)	nonsense	probably null
R0306:Smarca2	UTSW	19	26,618,013 (GRCm39)	missense	probably damaging	1.00
R0538:Smarca2	UTSW	19	26,668,762 (GRCm39)	missense	probably damaging	0.99
R0565:Smarca2	UTSW	19	26,659,275 (GRCm39)	missense	possibly damaging	0.71
R0610:Smarca2	UTSW	19	26,668,791 (GRCm39)	missense	probably damaging	1.00
R0669:Smarca2	UTSW	19	26,683,600 (GRCm39)	missense	possibly damaging	0.51
R0726:Smarca2	UTSW	19	26,675,803 (GRCm39)	missense	probably damaging	1.00
R1184:Smarca2	UTSW	19	26,748,333 (GRCm39)	splice site	probably benign
R1256:Smarca2	UTSW	19	26,659,373 (GRCm39)	missense	probably benign	0.06
R1299:Smarca2	UTSW	19	26,749,011 (GRCm39)	critical splice donor site	probably null
R1306:Smarca2	UTSW	19	26,748,388 (GRCm39)	missense	possibly damaging	0.81
R1381:Smarca2	UTSW	19	26,608,228 (GRCm39)	missense	probably damaging	1.00
R1400:Smarca2	UTSW	19	26,654,140 (GRCm39)	missense	probably damaging	0.98
R1415:Smarca2	UTSW	19	26,688,084 (GRCm39)	missense	probably null	0.72
R1496:Smarca2	UTSW	19	26,608,501 (GRCm39)	missense	possibly damaging	0.85
R1582:Smarca2	UTSW	19	26,729,305 (GRCm39)	missense	probably damaging	0.99
R1666:Smarca2	UTSW	19	26,624,434 (GRCm39)	missense	possibly damaging	0.65
R1668:Smarca2	UTSW	19	26,624,434 (GRCm39)	missense	possibly damaging	0.65
R1751:Smarca2	UTSW	19	26,617,780 (GRCm39)	splice site	probably benign
R1861:Smarca2	UTSW	19	26,601,284 (GRCm39)	missense	probably benign	0.03
R1962:Smarca2	UTSW	19	26,650,124 (GRCm39)	nonsense	probably null
R1964:Smarca2	UTSW	19	26,650,124 (GRCm39)	nonsense	probably null
R1998:Smarca2	UTSW	19	26,608,493 (GRCm39)	missense	probably benign	0.33
R2014:Smarca2	UTSW	19	26,661,305 (GRCm39)	missense	possibly damaging	0.86
R2255:Smarca2	UTSW	19	26,748,438 (GRCm39)	missense	probably benign	0.01
R2392:Smarca2	UTSW	19	26,618,050 (GRCm39)	critical splice donor site	probably null
R2439:Smarca2	UTSW	19	26,668,854 (GRCm39)	critical splice donor site	probably null
R3030:Smarca2	UTSW	19	26,729,429 (GRCm39)	missense	possibly damaging	0.84
R3195:Smarca2	UTSW	19	26,661,222 (GRCm39)	missense	possibly damaging	0.85
R3430:Smarca2	UTSW	19	26,668,749 (GRCm39)	missense	probably damaging	1.00
R3710:Smarca2	UTSW	19	26,646,290 (GRCm39)	unclassified	probably benign
R3845:Smarca2	UTSW	19	26,698,273 (GRCm39)	missense	probably benign	0.06
R4013:Smarca2	UTSW	19	26,661,327 (GRCm39)	splice site	probably null
R4014:Smarca2	UTSW	19	26,661,327 (GRCm39)	splice site	probably null
R4016:Smarca2	UTSW	19	26,661,327 (GRCm39)	splice site	probably null
R4271:Smarca2	UTSW	19	26,698,349 (GRCm39)	critical splice donor site	probably null
R4471:Smarca2	UTSW	19	26,597,277 (GRCm39)	missense	possibly damaging	0.86
R4612:Smarca2	UTSW	19	26,753,625 (GRCm39)	missense	possibly damaging	0.70
R4730:Smarca2	UTSW	19	26,608,073 (GRCm39)	missense	probably damaging	1.00
R4755:Smarca2	UTSW	19	26,631,883 (GRCm39)	missense	possibly damaging	0.86
R4999:Smarca2	UTSW	19	26,698,255 (GRCm39)	nonsense	probably null
R5015:Smarca2	UTSW	19	26,668,788 (GRCm39)	missense	possibly damaging	0.86
R5320:Smarca2	UTSW	19	26,668,772 (GRCm39)	missense	probably damaging	1.00
R5393:Smarca2	UTSW	19	26,617,829 (GRCm39)	missense	probably benign	0.18
R5503:Smarca2	UTSW	19	26,659,446 (GRCm39)	missense	possibly damaging	0.93
R5503:Smarca2	UTSW	19	26,601,336 (GRCm39)	missense	probably damaging	0.96
R5715:Smarca2	UTSW	19	26,626,522 (GRCm39)	missense	probably benign	0.16
R5790:Smarca2	UTSW	19	26,654,124 (GRCm39)	missense	probably damaging	1.00
R5874:Smarca2	UTSW	19	26,753,469 (GRCm39)	intron	probably benign
R6209:Smarca2	UTSW	19	26,748,404 (GRCm39)	nonsense	probably null
R6236:Smarca2	UTSW	19	26,673,613 (GRCm39)	missense	probably benign	0.33
R6291:Smarca2	UTSW	19	26,608,292 (GRCm39)	missense	probably damaging	1.00
R6292:Smarca2	UTSW	19	26,608,292 (GRCm39)	missense	probably damaging	1.00
R6325:Smarca2	UTSW	19	26,655,763 (GRCm39)	missense	probably damaging	0.99
R6544:Smarca2	UTSW	19	26,608,331 (GRCm39)	missense	probably damaging	1.00
R6572:Smarca2	UTSW	19	26,656,573 (GRCm39)	missense	possibly damaging	0.71
R6589:Smarca2	UTSW	19	26,597,284 (GRCm39)	missense	possibly damaging	0.53
R6601:Smarca2	UTSW	19	26,631,777 (GRCm39)	missense	probably benign	0.30
R6804:Smarca2	UTSW	19	26,729,286 (GRCm39)	missense	possibly damaging	0.93
R6922:Smarca2	UTSW	19	26,668,749 (GRCm39)	missense	probably damaging	1.00
R7047:Smarca2	UTSW	19	26,646,555 (GRCm39)	missense	possibly damaging	0.83
R7213:Smarca2	UTSW	19	26,624,531 (GRCm39)	missense	possibly damaging	0.96
R7257:Smarca2	UTSW	19	26,631,864 (GRCm39)	nonsense	probably null
R7259:Smarca2	UTSW	19	26,631,864 (GRCm39)	nonsense	probably null
R7479:Smarca2	UTSW	19	26,617,887 (GRCm39)	missense	probably benign	0.00
R7512:Smarca2	UTSW	19	26,661,209 (GRCm39)	missense	possibly damaging	0.51
R8158:Smarca2	UTSW	19	26,659,448 (GRCm39)	missense	probably benign	0.16
R8182:Smarca2	UTSW	19	26,608,120 (GRCm39)	missense	probably benign	0.39
R8207:Smarca2	UTSW	19	26,654,080 (GRCm39)	missense	possibly damaging	0.71
R8467:Smarca2	UTSW	19	26,597,121 (GRCm39)	start codon destroyed	probably null	0.02
R8527:Smarca2	UTSW	19	26,654,187 (GRCm39)	missense	probably damaging	0.98
R8784:Smarca2	UTSW	19	26,753,558 (GRCm39)	missense	probably benign	0.17
R8898:Smarca2	UTSW	19	26,608,358 (GRCm39)	unclassified	probably benign
R9076:Smarca2	UTSW	19	26,659,452 (GRCm39)	missense	possibly damaging	0.52
R9123:Smarca2	UTSW	19	26,693,583 (GRCm39)	missense	possibly damaging	0.84
R9125:Smarca2	UTSW	19	26,693,583 (GRCm39)	missense	possibly damaging	0.84
R9317:Smarca2	UTSW	19	26,737,279 (GRCm39)	missense	possibly damaging	0.75
R9501:Smarca2	UTSW	19	26,617,977 (GRCm39)	missense	probably benign	0.04
R9514:Smarca2	UTSW	19	26,659,452 (GRCm39)	missense	possibly damaging	0.71
R9641:Smarca2	UTSW	19	26,656,498 (GRCm39)	missense	possibly damaging	0.93
RF001:Smarca2	UTSW	19	26,608,421 (GRCm39)	unclassified	probably benign
RF001:Smarca2	UTSW	19	26,608,386 (GRCm39)	unclassified	probably benign
RF004:Smarca2	UTSW	19	26,608,420 (GRCm39)	unclassified	probably benign
RF019:Smarca2	UTSW	19	26,608,401 (GRCm39)	unclassified	probably benign
RF021:Smarca2	UTSW	19	26,608,397 (GRCm39)	unclassified	probably benign
RF024:Smarca2	UTSW	19	26,608,420 (GRCm39)	unclassified	probably benign
RF034:Smarca2	UTSW	19	26,608,411 (GRCm39)	unclassified	probably benign
RF040:Smarca2	UTSW	19	26,608,422 (GRCm39)	unclassified	probably benign
RF041:Smarca2	UTSW	19	26,608,421 (GRCm39)	unclassified	probably benign
RF047:Smarca2	UTSW	19	26,608,405 (GRCm39)	unclassified	probably benign
X0061:Smarca2	UTSW	19	26,698,240 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAACAGAGGTCCCTCGCCTTTC -3'
(R):5'- TGGCTTCTAGTAACCAAGTGCTTC -3'

Sequencing Primer
(F):5'- TCAGTCCTGTGCAGCTGC -3'
(R):5'- AACCAAGTGCTTCTGTGTGCAAG -3'

Posted On

2019-12-04