Incidental Mutation 'RF051:Gabre'
ID605154
Institutional Source Beutler Lab
Gene Symbol Gabre
Ensembl Gene ENSMUSG00000031340
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit epsilon
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF051 (G1)
Quality Score214.724
Status Not validated
ChromosomeX
Chromosomal Location72255999-72274803 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) CTCCGG to CTCCGGGTCCGG at 72270049 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064780]
Predicted Effect probably benign
Transcript: ENSMUST00000064780
SMART Domains Protein: ENSMUSP00000066543
Gene: ENSMUSG00000031340

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 40 55 N/A INTRINSIC
low complexity region 83 169 N/A INTRINSIC
low complexity region 173 219 N/A INTRINSIC
low complexity region 234 441 N/A INTRINSIC
Pfam:Neur_chan_LBD 482 688 1.4e-47 PFAM
Pfam:Neur_chan_memb 695 856 2.1e-23 PFAM
transmembrane domain 892 914 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 46,736,748 probably benign Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Gm14399 G C 2: 175,131,201 Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Mei1 GC GCTGGCTGCC 15: 82,070,010 probably null Het
Nbea TTTA T 3: 56,009,212 probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,941,054 probably benign Het
Olfr1535 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,555,523 probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Het
Plekhg2 GGTG GG 7: 28,362,352 probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,608,929 probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,630,988 probably benign Het
Stard8 GAG GAGCAG X: 99,066,524 probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,833,579 probably benign Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,362 probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,967,034 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,089,129 probably benign Het
Other mutations in Gabre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Gabre APN X 72274653 nonsense probably null
FR4304:Gabre UTSW X 72270042 small insertion probably benign
FR4589:Gabre UTSW X 72270030 small insertion probably benign
FR4589:Gabre UTSW X 72270042 small insertion probably benign
FR4976:Gabre UTSW X 72270418 small insertion probably benign
FR4976:Gabre UTSW X 72270422 small insertion probably benign
R7620:Gabre UTSW X 72270259 missense unknown
RF002:Gabre UTSW X 72270057 nonsense probably null
RF005:Gabre UTSW X 72270045 nonsense probably null
RF009:Gabre UTSW X 72270712 small deletion probably benign
RF009:Gabre UTSW X 72270713 small insertion probably benign
RF010:Gabre UTSW X 72270060 small insertion probably benign
RF013:Gabre UTSW X 72270416 small insertion probably benign
RF023:Gabre UTSW X 72270054 small insertion probably benign
RF024:Gabre UTSW X 72270177 frame shift probably null
RF028:Gabre UTSW X 72270763 small insertion probably benign
RF029:Gabre UTSW X 72270059 small insertion probably benign
RF034:Gabre UTSW X 72270762 small insertion probably benign
RF037:Gabre UTSW X 72270061 small insertion probably benign
RF041:Gabre UTSW X 72270049 small insertion probably benign
RF042:Gabre UTSW X 72270047 small insertion probably benign
RF043:Gabre UTSW X 72270048 small insertion probably benign
RF044:Gabre UTSW X 72270061 small insertion probably benign
RF045:Gabre UTSW X 72270045 small insertion probably benign
RF045:Gabre UTSW X 72270181 frame shift probably null
RF047:Gabre UTSW X 72270053 small insertion probably benign
RF047:Gabre UTSW X 72270765 nonsense probably null
RF049:Gabre UTSW X 72270277 frame shift probably null
RF050:Gabre UTSW X 72270741 nonsense probably null
RF052:Gabre UTSW X 72270047 small insertion probably benign
RF054:Gabre UTSW X 72270416 small insertion probably benign
RF055:Gabre UTSW X 72270177 frame shift probably null
RF058:Gabre UTSW X 72270063 small insertion probably benign
RF059:Gabre UTSW X 72270764 small insertion probably benign
RF061:Gabre UTSW X 72270048 small insertion probably benign
RF064:Gabre UTSW X 72270063 nonsense probably null
RF064:Gabre UTSW X 72270171 frame shift probably null
X0018:Gabre UTSW X 72270338 missense unknown
Predicted Primers PCR Primer
(F):5'- GGACTGGGGCTCTGATTTC -3'
(R):5'- ACCTCAGCCTCAGCCTCTG -3'

Sequencing Primer
(F):5'- GACTGGGGCTCTGATTTCATCTC -3'
(R):5'- TCAGCCTGAGCCACAGC -3'
Posted On2019-12-04