Incidental Mutation 'RF051:Gabre'
ID 605154
Institutional Source Beutler Lab
Gene Symbol Gabre
Ensembl Gene ENSMUSG00000031340
Gene Name gamma-aminobutyric acid (GABA) A receptor, subunit epsilon
Synonyms
Accession Numbers
Essential gene? Not available question?
Stock # RF051 (G1)
Quality Score 214.724
Status Not validated
Chromosome X
Chromosomal Location 71300532-71318433 bp(-) (GRCm39)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) CTCCGG to CTCCGGGTCCGG at 71313655 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064780]
AlphaFold A2AMW3
Predicted Effect probably benign
Transcript: ENSMUST00000064780
SMART Domains Protein: ENSMUSP00000066543
Gene: ENSMUSG00000031340

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 40 55 N/A INTRINSIC
low complexity region 83 169 N/A INTRINSIC
low complexity region 173 219 N/A INTRINSIC
low complexity region 234 441 N/A INTRINSIC
Pfam:Neur_chan_LBD 482 688 1.4e-47 PFAM
Pfam:Neur_chan_memb 695 856 2.1e-23 PFAM
transmembrane domain 892 914 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 47,047,674 (GRCm39) probably benign Het
Garin5a GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,149,947 (GRCm39) probably null Het
Gm14399 G C 2: 174,972,994 (GRCm39) Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 (GRCm39) probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 (GRCm39) probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,179,990 (GRCm39) probably benign Het
Kmt2c CCTTCT CCT 5: 25,518,477 (GRCm39) probably benign Het
Manbal CGATAGAAT C 2: 157,237,932 (GRCm39) probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Mei1 GC GCTGGCTGCC 15: 81,954,211 (GRCm39) probably null Het
Nalf2 GCCGCC GCCGCCACCGCC X: 98,864,968 (GRCm39) probably benign Het
Nbea TTTA T 3: 55,916,633 (GRCm39) probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,891,054 (GRCm39) probably benign Het
Or2b7 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,739,693 (GRCm39) probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,134,010 (GRCm39) probably benign Het
Plekhg2 GGTG GG 7: 28,061,777 (GRCm39) probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,756,788 (GRCm39) probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,608,388 (GRCm39) probably benign Het
Stard8 GAG GAGCAG X: 98,110,130 (GRCm39) probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,966,651 (GRCm39) probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,851,234 (GRCm39) probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,000,426 (GRCm39) probably benign Het
Other mutations in Gabre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Gabre APN X 71,318,259 (GRCm39) nonsense probably null
FR4304:Gabre UTSW X 71,313,648 (GRCm39) small insertion probably benign
FR4589:Gabre UTSW X 71,313,648 (GRCm39) small insertion probably benign
FR4589:Gabre UTSW X 71,313,636 (GRCm39) small insertion probably benign
FR4976:Gabre UTSW X 71,314,028 (GRCm39) small insertion probably benign
FR4976:Gabre UTSW X 71,314,024 (GRCm39) small insertion probably benign
R7620:Gabre UTSW X 71,313,865 (GRCm39) missense unknown
RF002:Gabre UTSW X 71,313,663 (GRCm39) nonsense probably null
RF005:Gabre UTSW X 71,313,651 (GRCm39) nonsense probably null
RF009:Gabre UTSW X 71,314,319 (GRCm39) small insertion probably benign
RF009:Gabre UTSW X 71,314,318 (GRCm39) small deletion probably benign
RF010:Gabre UTSW X 71,313,666 (GRCm39) small insertion probably benign
RF013:Gabre UTSW X 71,314,022 (GRCm39) small insertion probably benign
RF023:Gabre UTSW X 71,313,660 (GRCm39) small insertion probably benign
RF024:Gabre UTSW X 71,313,783 (GRCm39) frame shift probably null
RF028:Gabre UTSW X 71,314,369 (GRCm39) small insertion probably benign
RF029:Gabre UTSW X 71,313,665 (GRCm39) small insertion probably benign
RF034:Gabre UTSW X 71,314,368 (GRCm39) small insertion probably benign
RF037:Gabre UTSW X 71,313,667 (GRCm39) small insertion probably benign
RF041:Gabre UTSW X 71,313,655 (GRCm39) small insertion probably benign
RF042:Gabre UTSW X 71,313,653 (GRCm39) small insertion probably benign
RF043:Gabre UTSW X 71,313,654 (GRCm39) small insertion probably benign
RF044:Gabre UTSW X 71,313,667 (GRCm39) small insertion probably benign
RF045:Gabre UTSW X 71,313,787 (GRCm39) frame shift probably null
RF045:Gabre UTSW X 71,313,651 (GRCm39) small insertion probably benign
RF047:Gabre UTSW X 71,314,371 (GRCm39) nonsense probably null
RF047:Gabre UTSW X 71,313,659 (GRCm39) small insertion probably benign
RF049:Gabre UTSW X 71,313,883 (GRCm39) frame shift probably null
RF050:Gabre UTSW X 71,314,347 (GRCm39) nonsense probably null
RF052:Gabre UTSW X 71,313,653 (GRCm39) small insertion probably benign
RF054:Gabre UTSW X 71,314,022 (GRCm39) small insertion probably benign
RF055:Gabre UTSW X 71,313,783 (GRCm39) frame shift probably null
RF058:Gabre UTSW X 71,313,669 (GRCm39) small insertion probably benign
RF059:Gabre UTSW X 71,314,370 (GRCm39) small insertion probably benign
RF061:Gabre UTSW X 71,313,654 (GRCm39) small insertion probably benign
RF064:Gabre UTSW X 71,313,777 (GRCm39) frame shift probably null
RF064:Gabre UTSW X 71,313,669 (GRCm39) nonsense probably null
X0018:Gabre UTSW X 71,313,944 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGACTGGGGCTCTGATTTC -3'
(R):5'- ACCTCAGCCTCAGCCTCTG -3'

Sequencing Primer
(F):5'- GACTGGGGCTCTGATTTCATCTC -3'
(R):5'- TCAGCCTGAGCCACAGC -3'
Posted On 2019-12-04