Incidental Mutation 'RF051:Stard8'
ID605155
Institutional Source Beutler Lab
Gene Symbol Stard8
Ensembl Gene ENSMUSG00000031216
Gene NameSTART domain containing 8
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF051 (G1)
Quality Score193.468
Status Not validated
ChromosomeX
Chromosomal Location99003248-99074728 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GAG to GAGCAG at 99066524 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036606] [ENSMUST00000149999]
Predicted Effect probably benign
Transcript: ENSMUST00000036606
SMART Domains Protein: ENSMUSP00000044491
Gene: ENSMUSG00000031216

DomainStartEndE-ValueType
low complexity region 44 65 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 288 299 N/A INTRINSIC
coiled coil region 334 372 N/A INTRINSIC
low complexity region 396 417 N/A INTRINSIC
low complexity region 457 464 N/A INTRINSIC
RhoGAP 579 770 1.97e-56 SMART
START 814 1016 2.13e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149999
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of Rho GTPase activating proteins that contain a steroidogenic acute regulatory protein related lipid transfer domain. The encoded protein localizes to focal adhesions and may be involved in regulating cell morphology. This protein may also function as a tumor suppressor. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 46,736,748 probably benign Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Gabre CTCCGG CTCCGGGTCCGG X: 72,270,049 probably benign Het
Gm14399 G C 2: 175,131,201 Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Mei1 GC GCTGGCTGCC 15: 82,070,010 probably null Het
Nbea TTTA T 3: 56,009,212 probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,941,054 probably benign Het
Olfr1535 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,555,523 probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Het
Plekhg2 GGTG GG 7: 28,362,352 probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,608,929 probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,630,988 probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,833,579 probably benign Het
Tmem28 GCCGCC GCCGCCACCGCC X: 99,821,362 probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,967,034 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,089,129 probably benign Het
Other mutations in Stard8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Stard8 APN X 99069335 missense probably damaging 1.00
IGL01063:Stard8 APN X 99073088 missense probably damaging 1.00
FR4304:Stard8 UTSW X 99066505 unclassified probably benign
FR4976:Stard8 UTSW X 99066513 unclassified probably benign
FR4976:Stard8 UTSW X 99066525 unclassified probably benign
R4198:Stard8 UTSW X 99066508 unclassified probably benign
R4641:Stard8 UTSW X 99066508 unclassified probably benign
R8246:Stard8 UTSW X 99065964 missense probably benign
R8247:Stard8 UTSW X 99065964 missense probably benign
RF002:Stard8 UTSW X 99066515 nonsense probably null
RF010:Stard8 UTSW X 99066517 unclassified probably benign
RF043:Stard8 UTSW X 99066520 unclassified probably benign
RF043:Stard8 UTSW X 99066527 unclassified probably benign
RF055:Stard8 UTSW X 99066520 unclassified probably benign
RF063:Stard8 UTSW X 99066524 nonsense probably null
RF064:Stard8 UTSW X 99066527 nonsense probably null
X0004:Stard8 UTSW X 99066683 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- ATACAGGCTGAAGCTGAGGC -3'
(R):5'- TCTGCAGTCGAGTTAGCTTC -3'

Sequencing Primer
(F):5'- GCTGAGGCTGAAGCTGAG -3'
(R):5'- AGCCTGTACCAATGGTTCGAC -3'
Posted On2019-12-04