Incidental Mutation 'RF051:Tmem28'
ID605156
Institutional Source Beutler Lab
Gene Symbol Tmem28
Ensembl Gene ENSMUSG00000071719
Gene Nametransmembrane protein 28
SynonymsEG620592, Fam155b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #RF051 (G1)
Quality Score122.467
Status Not validated
ChromosomeX
Chromosomal Location99821021-99848790 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCCGCC to GCCGCCACCGCC at 99821362 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096363]
Predicted Effect probably benign
Transcript: ENSMUST00000096363
SMART Domains Protein: ENSMUSP00000094090
Gene: ENSMUSG00000071719

DomainStartEndE-ValueType
low complexity region 90 112 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a product belonging to a family of proteins with unknown function. The presence of two transmembrane domains suggests that this protein is a multi-pass membrane protein. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cnpy3 CTC CTCATC 17: 46,736,748 probably benign Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Gabre CTCCGG CTCCGGGTCCGG X: 72,270,049 probably benign Het
Gm14399 G C 2: 175,131,201 Q254E probably benign Het
Hsdl2 TGC TGCCGGAGCAGCCACAGCGGC 4: 59,610,636 probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG 4: 59,610,650 probably benign Het
Il2 GGG GGGGCTTGAAGTGGG 3: 37,125,841 probably benign Het
Kmt2c CCTTCT CCT 5: 25,313,479 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Mei1 GC GCTGGCTGCC 15: 82,070,010 probably null Het
Nbea TTTA T 3: 56,009,212 probably benign Het
Nefh TGGCC TGGCCGCACCTGGGGCCTCGGCC 11: 4,941,054 probably benign Het
Olfr1535 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT 13: 21,555,523 probably null Het
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Het
Plekhg2 GGTG GG 7: 28,362,352 probably null Het
Rassf6 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA 5: 90,608,929 probably benign Het
Smarca2 AGCAGC AGCAGCCGCAGC 19: 26,630,988 probably benign Het
Stard8 GAG GAGCAG X: 99,066,524 probably benign Het
Tcof1 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC 18: 60,833,579 probably benign Het
Triobp AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG 15: 78,967,034 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTCT 9: 44,089,129 probably benign Het
Other mutations in Tmem28
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3405:Tmem28 UTSW X 99845503 missense probably benign 0.02
R3406:Tmem28 UTSW X 99845503 missense probably benign 0.02
R3932:Tmem28 UTSW X 99821864 missense possibly damaging 0.94
R3933:Tmem28 UTSW X 99821864 missense possibly damaging 0.94
RF011:Tmem28 UTSW X 99821361 small insertion probably benign
RF017:Tmem28 UTSW X 99821365 small insertion probably benign
RF018:Tmem28 UTSW X 99821361 small insertion probably benign
RF033:Tmem28 UTSW X 99821373 small insertion probably benign
RF039:Tmem28 UTSW X 99821372 small insertion probably benign
X0033:Tmem28 UTSW X 99821121 small deletion probably benign
X0036:Tmem28 UTSW X 99821121 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGGCAGAGCGACAAACCTTG -3'
(R):5'- GTGGTCGGTTCGAAAAGTCTC -3'

Sequencing Primer
(F):5'- AAACCTTGCGCCGATTCG -3'
(R):5'- TCGGTTCGAAAAGTCTCTGCAAAG -3'
Posted On2019-12-04