Mutagenetix > Incidental Mutations

Incidental Mutation 'R0128:Sim1'

60516

Institutional Source

Beutler Lab

Gene Symbol

Sim1

Ensembl Gene

ENSMUSG00000019913

Gene Name

single-minded family bHLH transcription factor 1

Synonyms

bHLHe14

MMRRC Submission

038413-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0128 (G1)

Quality Score

220

Status

Validated

Chromosome

Chromosomal Location

50894754-50989152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 50907961 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 104 (I104F)

Ref Sequence

ENSEMBL: ENSMUSP00000020071 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020071]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020071
AA Change: I104F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020071
Gene: ENSMUSG00000019913
AA Change: I104F

Domain	Start	End	E-Value	Type
HLH	6	59	8.73e-6	SMART
PAS	79	145	7.39e-14	SMART
PAS	220	286	5.61e-5	SMART
PAC	292	335	4.63e-6	SMART
Pfam:SIM_C	359	668	2.5e-114	PFAM

Meta Mutation Damage Score

0.4581

Coding Region Coverage

1x: 99.0%
3x: 97.6%
10x: 93.0%
20x: 79.3%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIM1 and SIM2 genes are Drosophila single-minded (sim) gene homologs. SIM1 transcript was detected only in fetal kidney out of various adult and fetal tissues tested. Since the sim gene plays an important role in Drosophila development and has peak levels of expression during the period of neurogenesis,it was proposed that the human SIM gene is a candidate for involvement in certain dysmorphic features (particularly the facial and skull characteristics), abnormalities of brain development, and/or mental retardation of Down syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with abnormalities in the paraventricular and supraoptic nuclei. Heterozygous mutant mice are obese and may also be diabetic, hyperinsulinemic and insulin resistant. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,575,639		probably benign	Het
Abcd4	T	G	12: 84,612,352	Q210P	possibly damaging	Het
Ablim2	G	A	5: 35,809,176		probably benign	Het
Actl6b	A	G	5: 137,555,065	N113S	probably benign	Het
Actn3	A	T	19: 4,871,615	V179E	probably damaging	Het
Aff4	C	A	11: 53,415,466	T1145N	probably damaging	Het
Ankrd42	G	A	7: 92,591,859	Q431*	probably null	Het
Anxa9	A	G	3: 95,302,422	S129P	probably benign	Het
Arfgef2	T	G	2: 166,835,719	I88S	probably damaging	Het
Asap3	C	A	4: 136,234,604	N285K	probably damaging	Het
Atp6v0a2	A	G	5: 124,713,184	N477S	probably damaging	Het
Atp7b	C	T	8: 22,028,172	E205K	possibly damaging	Het
Atp8b5	T	A	4: 43,369,715		probably null	Het
C87436	G	A	6: 86,469,827	G533D	probably damaging	Het
Ccdc138	T	A	10: 58,528,360	I314N	probably damaging	Het
Ccs	A	G	19: 4,825,626	F237S	probably damaging	Het
Ccz1	T	G	5: 144,009,294		probably benign	Het
Cdcp2	C	T	4: 107,106,707		probably benign	Het
Chd1	A	G	17: 17,393,567	N531S	probably damaging	Het
Clptm1	A	T	7: 19,635,007	F476I	probably damaging	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cped1	T	A	6: 22,121,039	Y373N	probably benign	Het
Cr2	A	T	1: 195,166,231	V328D	probably damaging	Het
D630045J12Rik	A	T	6: 38,149,771		probably benign	Het
Dcdc2a	A	T	13: 25,187,672		probably benign	Het
Dlg1	G	T	16: 31,858,065		probably null	Het
Epb41l5	A	C	1: 119,549,902	V705G	possibly damaging	Het
Ergic3	C	A	2: 156,011,140	R43S	possibly damaging	Het
Flnb	T	C	14: 7,901,951	V938A	probably damaging	Het
Frmd4a	T	C	2: 4,604,092	Y928H	probably damaging	Het
Fyn	C	T	10: 39,511,982	T78M	probably benign	Het
Gdap2	A	G	3: 100,201,995	T443A	probably damaging	Het
Ghrl	A	T	6: 113,717,168		probably benign	Het
Gm1141	T	C	X: 71,939,555	C378R	possibly damaging	Het
Gm12166	A	G	11: 46,052,293	M1T	probably null	Het
Gm4787	T	A	12: 81,377,747	K546*	probably null	Het
Gm498	G	T	7: 143,891,755	G178C	probably damaging	Het
Gm6576	C	G	15: 27,026,000		noncoding transcript	Het
Got1	C	T	19: 43,524,377	D27N	probably benign	Het
Gucy2c	C	T	6: 136,704,249	V946I	probably damaging	Het
Hectd4	T	C	5: 121,349,243	Y3434H	possibly damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Itpr1	A	G	6: 108,471,209		probably benign	Het
Kctd1	G	A	18: 14,974,180	P743S	probably benign	Het
Klhl23	T	C	2: 69,833,966	V553A	probably damaging	Het
Krt24	T	C	11: 99,280,267	D495G	probably damaging	Het
L3hypdh	C	T	12: 72,077,143		probably null	Het
Lipo3	C	T	19: 33,557,106		probably null	Het
Lman2l	G	T	1: 36,424,864	S171*	probably null	Het
Lrp1b	T	C	2: 41,511,508	D378G	probably damaging	Het
Map3k4	T	A	17: 12,248,063	D1104V	probably damaging	Het
Mpeg1	T	C	19: 12,461,223	V15A	probably benign	Het
Narf	C	T	11: 121,250,836	R356C	probably damaging	Het
Nebl	T	A	2: 17,393,023	Q487H	possibly damaging	Het
Olfm5	G	A	7: 104,160,926	A76V	probably benign	Het
Olfr1090	T	C	2: 86,753,887	M284V	probably benign	Het
Olfr339	T	A	2: 36,422,287	D296E	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr656	A	T	7: 104,618,581	I301F	probably damaging	Het
Olfr992	T	A	2: 85,399,961	S191C	probably damaging	Het
Palb2	A	T	7: 122,128,166	Y160*	probably null	Het
Paxip1	C	T	5: 27,744,185		probably benign	Het
Pclo	A	G	5: 14,679,797		probably benign	Het
Pdcd11	G	A	19: 47,119,862	V1223I	probably benign	Het
Pde6c	T	C	19: 38,169,365		probably benign	Het
Prr12	A	G	7: 45,050,039		probably benign	Het
Prss39	T	A	1: 34,502,200		probably benign	Het
Samd5	A	G	10: 9,674,939	W9R	probably damaging	Het
Sfr1	A	G	19: 47,735,018	*320W	probably null	Het
Sh3bp4	A	G	1: 89,145,314	N628S	possibly damaging	Het
Slc1a3	T	C	15: 8,636,209	M519V	probably benign	Het
Smcp	T	A	3: 92,584,520	T7S	unknown	Het
Sp4	A	G	12: 118,300,816		probably benign	Het
Spag9	T	A	11: 94,093,539	I327N	probably damaging	Het
Thbs4	G	T	13: 92,754,410	H850N	probably benign	Het
Ubap2l	A	T	3: 90,021,373	S478T	possibly damaging	Het
Unc79	A	G	12: 103,088,434		probably benign	Het
Vmn2r85	A	G	10: 130,419,185		probably benign	Het
Wrap73	A	G	4: 154,142,500	D19G	possibly damaging	Het

Other mutations in Sim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Sim1	APN	10	50981534	missense	probably damaging	0.99
IGL01142:Sim1	APN	10	50910671	missense	probably damaging	0.99
IGL01886:Sim1	APN	10	50984315	missense	probably damaging	1.00
PIT4585001:Sim1	UTSW	10	50984188	nonsense	probably null
R0130:Sim1	UTSW	10	50907961	missense	probably damaging	1.00
R0717:Sim1	UTSW	10	50909828	missense	probably damaging	1.00
R0948:Sim1	UTSW	10	50981327	nonsense	probably null
R1169:Sim1	UTSW	10	50981522	missense	probably benign	0.13
R1388:Sim1	UTSW	10	50895994	missense	probably damaging	1.00
R1746:Sim1	UTSW	10	50984109	missense	probably benign
R1778:Sim1	UTSW	10	50981553	nonsense	probably null
R1834:Sim1	UTSW	10	50909828	missense	probably damaging	1.00
R2434:Sim1	UTSW	10	50907958	missense	probably damaging	1.00
R2919:Sim1	UTSW	10	50909815	missense	probably benign	0.23
R3617:Sim1	UTSW	10	50909528	missense	probably damaging	1.00
R3625:Sim1	UTSW	10	50981336	missense	probably benign	0.30
R4152:Sim1	UTSW	10	50983854	missense	probably damaging	0.98
R4414:Sim1	UTSW	10	50981612	missense	probably benign	0.13
R4645:Sim1	UTSW	10	50983997	missense	probably benign	0.13
R4781:Sim1	UTSW	10	50983785	missense	probably benign	0.08
R4889:Sim1	UTSW	10	50981324	missense	probably benign	0.05
R4924:Sim1	UTSW	10	50909902	missense	probably damaging	1.00
R6625:Sim1	UTSW	10	50983986	missense	probably benign
R6783:Sim1	UTSW	10	50908727	missense	possibly damaging	0.72
R6876:Sim1	UTSW	10	50983695	missense	possibly damaging	0.77
R6909:Sim1	UTSW	10	50909410	missense	possibly damaging	0.92
R6924:Sim1	UTSW	10	50908539	missense	probably benign	0.10
R7016:Sim1	UTSW	10	50984250	missense	probably benign	0.03
R7135:Sim1	UTSW	10	50895927	missense	probably damaging	0.99
R7149:Sim1	UTSW	10	50909540	missense	probably damaging	1.00
R7300:Sim1	UTSW	10	50909518	missense	probably benign	0.23
R7750:Sim1	UTSW	10	50896035	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GCTGGACCTATTTCCTGTTGAAGGC -3'
(R):5'- GCGGAGCTATTGAGTCATCCTGTC -3'

Sequencing Primer
(F):5'- ACTTACAGACCTGGGAGGTTC -3'
(R):5'- GAGTCATCCTGTCTGTCACCTAAG -3'

Posted On

2013-07-24