Incidental Mutation 'RF053:A030005L19Rik'
ID605175
Institutional Source Beutler Lab
Gene Symbol A030005L19Rik
Ensembl Gene ENSMUSG00000113880
Gene NameRIKEN cDNA A030005L19 gene
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF053 (G1)
Quality Score132.981
Status Not validated
Chromosome1
Chromosomal Location82913325-82914130 bp(+) (GRCm38)
Type of Mutationsmall insertion (3 aa in frame mutation)
DNA Base Change (assembly) TGGCTGCTG to TGGCTGCTGGGGCTGCTG at 82913573 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152156 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000220768
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra TGGC T 15: 41,866,299 probably benign Het
Blm CTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTC 7: 80,512,921 probably benign Het
Bmp5 TGAGGAG T 9: 75,776,374 probably benign Het
Cngb1 GGCTCTGGCTCTGGCTCTGGCTCTG GG 8: 95,303,648 probably null Het
Cyb5r4 GGATGTGACAGACACACTGCCCAG GGATGTGACAGACACACTGCCCAGCGATGTGACAGACACACTGCCCAG 9: 87,040,422 probably benign Het
Ehbp1l1 TCACACCACC T 19: 5,716,002 probably benign Het
Kdm3a TTTTT TTTTTT 6: 71,632,049 probably benign Het
Krtap28-10 CAGCCACCACAGC CAGCCACCACAGCCAAAGCCACCACAGC 1: 83,042,278 probably benign Het
Mamld1 CA CAGAA X: 71,118,852 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,290 probably benign Het
Med12l CAG CAGAAG 3: 59,275,993 probably benign Het
Nefh GACTTGGCCTCACCT GACTTGGCCTCACCTCACCACTTGGCCTCACCT 11: 4,941,014 probably null Het
Rap1gds1 TCATTTATTATGACCATAC TC 3: 138,941,657 probably null Het
Tcof1 C CAGA 18: 60,835,747 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,114 probably benign Het
Trappc9 TGCT TGCTGCTGCTGCTGCGGCT 15: 72,801,328 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTAA 9: 44,089,129 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Zfp69 GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGATGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC 4: 120,947,347 probably benign Het
Znrd1as CACCAC CACCACCACCACCACCACCTCTACCAC 17: 36,965,066 probably benign Het
Other mutations in A030005L19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
RF001:A030005L19Rik UTSW 1 82913590 small insertion probably benign
RF005:A030005L19Rik UTSW 1 82913585 small insertion probably benign
RF011:A030005L19Rik UTSW 1 82913569 small insertion probably benign
RF011:A030005L19Rik UTSW 1 82913573 small insertion probably benign
RF011:A030005L19Rik UTSW 1 82913586 small insertion probably benign
RF016:A030005L19Rik UTSW 1 82913577 small insertion probably benign
RF018:A030005L19Rik UTSW 1 82913572 small insertion probably benign
RF021:A030005L19Rik UTSW 1 82913569 small insertion probably benign
RF023:A030005L19Rik UTSW 1 82913396 small deletion probably benign
RF028:A030005L19Rik UTSW 1 82913578 small insertion probably benign
RF028:A030005L19Rik UTSW 1 82913580 small insertion probably benign
RF034:A030005L19Rik UTSW 1 82913580 small insertion probably benign
RF035:A030005L19Rik UTSW 1 82913589 small insertion probably benign
RF038:A030005L19Rik UTSW 1 82913580 small insertion probably benign
RF040:A030005L19Rik UTSW 1 82913577 small insertion probably benign
RF040:A030005L19Rik UTSW 1 82913590 small insertion probably benign
RF042:A030005L19Rik UTSW 1 82913584 small insertion probably benign
RF044:A030005L19Rik UTSW 1 82913589 small insertion probably benign
RF059:A030005L19Rik UTSW 1 82913579 small insertion probably benign
RF060:A030005L19Rik UTSW 1 82913396 small deletion probably benign
RF060:A030005L19Rik UTSW 1 82913579 nonsense probably null
RF060:A030005L19Rik UTSW 1 82913587 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GAGTCCTCTCTACTGACAACATGG -3'
(R):5'- AGTGTGGCCTCCATATCTCC -3'

Sequencing Primer
(F):5'- CAACATGGGTTGCTGTGGC -3'
(R):5'- AGAGCACCTGGTTCTACTAGCAG -3'
Posted On2019-12-04