Incidental Mutation 'RF053:Krtap28-10'
ID605176
Institutional Source Beutler Lab
Gene Symbol Krtap28-10
Ensembl Gene ENSMUSG00000100190
Gene Namekeratin associated protein 28-10
Synonyms4733401N17Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF053 (G1)
Quality Score217.471
Status Not validated
Chromosome1
Chromosomal Location83041524-83042480 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CAGCCACCACAGC to CAGCCACCACAGCCAAAGCCACCACAGC at 83042278 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473] [ENSMUST00000188323] [ENSMUST00000222567]
Predicted Effect probably benign
Transcript: ENSMUST00000045560
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164473
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188323
Predicted Effect probably benign
Transcript: ENSMUST00000222567
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
Abra TGGC T 15: 41,866,299 probably benign Het
Blm CTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTC 7: 80,512,921 probably benign Het
Bmp5 TGAGGAG T 9: 75,776,374 probably benign Het
Cngb1 GGCTCTGGCTCTGGCTCTGGCTCTG GG 8: 95,303,648 probably null Het
Cyb5r4 GGATGTGACAGACACACTGCCCAG GGATGTGACAGACACACTGCCCAGCGATGTGACAGACACACTGCCCAG 9: 87,040,422 probably benign Het
Ehbp1l1 TCACACCACC T 19: 5,716,002 probably benign Het
Kdm3a TTTTT TTTTTT 6: 71,632,049 probably benign Het
Mamld1 CA CAGAA X: 71,118,852 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,290 probably benign Het
Med12l CAG CAGAAG 3: 59,275,993 probably benign Het
Nefh GACTTGGCCTCACCT GACTTGGCCTCACCTCACCACTTGGCCTCACCT 11: 4,941,014 probably null Het
Rap1gds1 TCATTTATTATGACCATAC TC 3: 138,941,657 probably null Het
Tcof1 C CAGA 18: 60,835,747 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,114 probably benign Het
Trappc9 TGCT TGCTGCTGCTGCTGCGGCT 15: 72,801,328 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTAA 9: 44,089,129 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Zfp69 GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGATGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC 4: 120,947,347 probably benign Het
Znrd1as CACCAC CACCACCACCACCACCACCTCTACCAC 17: 36,965,066 probably benign Het
Other mutations in Krtap28-10
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042255 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042280 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042282 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042128 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042135 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042253 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042279 unclassified probably benign
RF012:Krtap28-10 UTSW 1 83042136 unclassified probably benign
RF013:Krtap28-10 UTSW 1 83042135 unclassified probably benign
RF013:Krtap28-10 UTSW 1 83042274 unclassified probably benign
RF014:Krtap28-10 UTSW 1 83042251 unclassified probably benign
RF016:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF017:Krtap28-10 UTSW 1 83042138 unclassified probably benign
RF017:Krtap28-10 UTSW 1 83042266 unclassified probably benign
RF018:Krtap28-10 UTSW 1 83042253 unclassified probably benign
RF019:Krtap28-10 UTSW 1 83042269 unclassified probably benign
RF023:Krtap28-10 UTSW 1 83042146 nonsense probably null
RF023:Krtap28-10 UTSW 1 83042286 unclassified probably benign
RF024:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF024:Krtap28-10 UTSW 1 83042252 unclassified probably benign
RF025:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF026:Krtap28-10 UTSW 1 83042126 unclassified probably benign
RF027:Krtap28-10 UTSW 1 83042285 unclassified probably benign
RF028:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF029:Krtap28-10 UTSW 1 83042270 unclassified probably benign
RF032:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF034:Krtap28-10 UTSW 1 83042282 unclassified probably benign
RF035:Krtap28-10 UTSW 1 83042146 unclassified probably benign
RF035:Krtap28-10 UTSW 1 83042281 unclassified probably benign
RF037:Krtap28-10 UTSW 1 83042145 unclassified probably benign
RF037:Krtap28-10 UTSW 1 83042286 unclassified probably benign
RF038:Krtap28-10 UTSW 1 83042128 unclassified probably benign
RF038:Krtap28-10 UTSW 1 83042257 unclassified probably benign
RF042:Krtap28-10 UTSW 1 83042125 unclassified probably benign
RF044:Krtap28-10 UTSW 1 83042131 unclassified probably benign
RF045:Krtap28-10 UTSW 1 83042143 unclassified probably benign
RF045:Krtap28-10 UTSW 1 83042261 unclassified probably benign
RF049:Krtap28-10 UTSW 1 83042138 unclassified probably benign
RF049:Krtap28-10 UTSW 1 83042285 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042130 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042262 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042270 unclassified probably benign
RF058:Krtap28-10 UTSW 1 83042262 unclassified probably benign
RF059:Krtap28-10 UTSW 1 83042275 unclassified probably benign
RF059:Krtap28-10 UTSW 1 83042290 unclassified probably benign
RF061:Krtap28-10 UTSW 1 83042281 unclassified probably benign
RF064:Krtap28-10 UTSW 1 83042131 unclassified probably benign
Z1177:Krtap28-10 UTSW 1 83042159 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTAGCAGCAGCACTTCTTG -3'
(R):5'- CTCCTTGAAGCAAAGGCCATC -3'

Sequencing Primer
(F):5'- TGGCAGCAGCACTTCTG -3'
(R):5'- TTGAAGCAAAGGCCATCACATCTC -3'
Posted On2019-12-04