Incidental Mutation 'RF053:Zfp69'
ID605180
Institutional Source Beutler Lab
Gene Symbol Zfp69
Ensembl Gene ENSMUSG00000064141
Gene Namezinc finger protein 69
SynonymsZfp63, LOC381549, KRAB2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF053 (G1)
Quality Score214.458
Status Not validated
Chromosome4
Chromosomal Location120930137-120951699 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGATGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC to GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC at 120947347 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106280] [ENSMUST00000106281] [ENSMUST00000130702]
Predicted Effect probably benign
Transcript: ENSMUST00000106280
SMART Domains Protein: ENSMUSP00000101887
Gene: ENSMUSG00000064141

DomainStartEndE-ValueType
internal_repeat_1 32 80 1.53e-8 PROSPERO
KRAB 131 192 1.15e-32 SMART
ZnF_C2H2 324 346 1.13e-4 SMART
ZnF_C2H2 352 374 2.79e-4 SMART
ZnF_C2H2 380 402 1.04e-3 SMART
ZnF_C2H2 408 430 1.12e-3 SMART
ZnF_C2H2 436 458 1.82e-3 SMART
ZnF_C2H2 464 486 3.29e-1 SMART
ZnF_C2H2 492 514 1.38e-3 SMART
ZnF_C2H2 520 542 3.29e-1 SMART
ZnF_C2H2 548 570 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106281
SMART Domains Protein: ENSMUSP00000101888
Gene: ENSMUSG00000064141

DomainStartEndE-ValueType
internal_repeat_1 32 80 1.53e-8 PROSPERO
KRAB 131 192 1.15e-32 SMART
ZnF_C2H2 324 346 1.13e-4 SMART
ZnF_C2H2 352 374 2.79e-4 SMART
ZnF_C2H2 380 402 1.04e-3 SMART
ZnF_C2H2 408 430 1.12e-3 SMART
ZnF_C2H2 436 458 1.82e-3 SMART
ZnF_C2H2 464 486 3.29e-1 SMART
ZnF_C2H2 492 514 1.38e-3 SMART
ZnF_C2H2 520 542 3.29e-1 SMART
ZnF_C2H2 548 570 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130702
SMART Domains Protein: ENSMUSP00000133312
Gene: ENSMUSG00000064141

DomainStartEndE-ValueType
KRAB 1 32 2.6e-2 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
Abra TGGC T 15: 41,866,299 probably benign Het
Blm CTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTC 7: 80,512,921 probably benign Het
Bmp5 TGAGGAG T 9: 75,776,374 probably benign Het
Cngb1 GGCTCTGGCTCTGGCTCTGGCTCTG GG 8: 95,303,648 probably null Het
Cyb5r4 GGATGTGACAGACACACTGCCCAG GGATGTGACAGACACACTGCCCAGCGATGTGACAGACACACTGCCCAG 9: 87,040,422 probably benign Het
Ehbp1l1 TCACACCACC T 19: 5,716,002 probably benign Het
Kdm3a TTTTT TTTTTT 6: 71,632,049 probably benign Het
Krtap28-10 CAGCCACCACAGC CAGCCACCACAGCCAAAGCCACCACAGC 1: 83,042,278 probably benign Het
Mamld1 CA CAGAA X: 71,118,852 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,290 probably benign Het
Med12l CAG CAGAAG 3: 59,275,993 probably benign Het
Nefh GACTTGGCCTCACCT GACTTGGCCTCACCTCACCACTTGGCCTCACCT 11: 4,941,014 probably null Het
Rap1gds1 TCATTTATTATGACCATAC TC 3: 138,941,657 probably null Het
Tcof1 C CAGA 18: 60,835,747 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,114 probably benign Het
Trappc9 TGCT TGCTGCTGCTGCTGCGGCT 15: 72,801,328 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTAA 9: 44,089,129 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Znrd1as CACCAC CACCACCACCACCACCACCTCTACCAC 17: 36,965,066 probably benign Het
Other mutations in Zfp69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Zfp69 APN 4 120931500 missense probably damaging 1.00
IGL02604:Zfp69 APN 4 120931463 missense probably benign 0.10
IGL03406:Zfp69 APN 4 120931084 missense probably benign
R0505:Zfp69 UTSW 4 120931095 missense probably damaging 1.00
R0613:Zfp69 UTSW 4 120934347 missense probably benign
R0628:Zfp69 UTSW 4 120949425 nonsense probably null
R0838:Zfp69 UTSW 4 120931281 missense probably benign 0.09
R1669:Zfp69 UTSW 4 120947498 utr 5 prime probably benign
R2060:Zfp69 UTSW 4 120930832 missense probably damaging 0.98
R3740:Zfp69 UTSW 4 120930874 splice site probably null
R4242:Zfp69 UTSW 4 120934475 intron probably benign
R4770:Zfp69 UTSW 4 120934417 missense probably damaging 0.99
R4998:Zfp69 UTSW 4 120947325 missense possibly damaging 0.52
R5620:Zfp69 UTSW 4 120930522 missense probably damaging 1.00
R6312:Zfp69 UTSW 4 120949517 unclassified probably benign
R6534:Zfp69 UTSW 4 120931197 missense probably benign 0.05
R7056:Zfp69 UTSW 4 120931098 missense probably benign 0.01
R7061:Zfp69 UTSW 4 120931401 missense possibly damaging 0.69
R7663:Zfp69 UTSW 4 120935126 missense probably benign 0.17
R8169:Zfp69 UTSW 4 120930534 missense probably damaging 1.00
R8389:Zfp69 UTSW 4 120949352 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GAGTAACTTGCCTGGACTCC -3'
(R):5'- AGCTCTGCTATCCCATGATGC -3'

Sequencing Primer
(F):5'- GGACTCCCTCCATATTGAATTATTGG -3'
(R):5'- TGCTATCCCATGATGCTAATGG -3'
Posted On2019-12-04