Incidental Mutation 'RF053:Cngb1'
ID605183
Institutional Source Beutler Lab
Gene Symbol Cngb1
Ensembl Gene ENSMUSG00000031789
Gene Namecyclic nucleotide gated channel beta 1
SynonymsBC016201, Cngb1b, Cngb1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF053 (G1)
Quality Score217.468
Status Not validated
Chromosome8
Chromosomal Location95239045-95306585 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GGCTCTGGCTCTGGCTCTGGCTCTG to GG at 95303648 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093268] [ENSMUST00000119870] [ENSMUST00000133716] [ENSMUST00000134207] [ENSMUST00000156514]
Predicted Effect probably null
Transcript: ENSMUST00000093268
SMART Domains Protein: ENSMUSP00000090956
Gene: ENSMUSG00000031789

DomainStartEndE-ValueType
low complexity region 33 103 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119870
SMART Domains Protein: ENSMUSP00000113827
Gene: ENSMUSG00000031789

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
Pfam:Ion_trans 83 315 9.8e-17 PFAM
cNMP 389 508 4.1e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133716
Predicted Effect probably null
Transcript: ENSMUST00000134207
Predicted Effect probably null
Transcript: ENSMUST00000156514
Predicted Effect probably benign
Transcript: ENSMUST00000212237
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display postnatal lethality, reduced body size and weight, and retinal rod degeneration followed by cone degeneration. Mice homozygous for an allele lacking the calmodulin-binding domain exhibit defective olfactory neural signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
Abra TGGC T 15: 41,866,299 probably benign Het
Blm CTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTC 7: 80,512,921 probably benign Het
Bmp5 TGAGGAG T 9: 75,776,374 probably benign Het
Cyb5r4 GGATGTGACAGACACACTGCCCAG GGATGTGACAGACACACTGCCCAGCGATGTGACAGACACACTGCCCAG 9: 87,040,422 probably benign Het
Ehbp1l1 TCACACCACC T 19: 5,716,002 probably benign Het
Kdm3a TTTTT TTTTTT 6: 71,632,049 probably benign Het
Krtap28-10 CAGCCACCACAGC CAGCCACCACAGCCAAAGCCACCACAGC 1: 83,042,278 probably benign Het
Mamld1 CA CAGAA X: 71,118,852 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,290 probably benign Het
Med12l CAG CAGAAG 3: 59,275,993 probably benign Het
Nefh GACTTGGCCTCACCT GACTTGGCCTCACCTCACCACTTGGCCTCACCT 11: 4,941,014 probably null Het
Rap1gds1 TCATTTATTATGACCATAC TC 3: 138,941,657 probably null Het
Tcof1 C CAGA 18: 60,835,747 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,114 probably benign Het
Trappc9 TGCT TGCTGCTGCTGCTGCGGCT 15: 72,801,328 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTAA 9: 44,089,129 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Zfp69 GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGATGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC 4: 120,947,347 probably benign Het
Znrd1as CACCAC CACCACCACCACCACCACCTCTACCAC 17: 36,965,066 probably benign Het
Other mutations in Cngb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cngb1 APN 8 95242184 splice site probably benign
IGL01575:Cngb1 APN 8 95264520 missense possibly damaging 0.51
IGL02329:Cngb1 APN 8 95242359 missense probably benign 0.14
IGL03332:Cngb1 APN 8 95298846 splice site probably benign
IGL03391:Cngb1 APN 8 95303705 unclassified probably benign
stevie UTSW 8 95260130 missense probably damaging 1.00
R0078:Cngb1 UTSW 8 95264545 critical splice acceptor site probably null
R0116:Cngb1 UTSW 8 95260638 missense probably damaging 1.00
R1073:Cngb1 UTSW 8 95303567 critical splice donor site probably null
R1166:Cngb1 UTSW 8 95260181 missense probably damaging 0.99
R1714:Cngb1 UTSW 8 95257931 missense probably damaging 1.00
R1753:Cngb1 UTSW 8 95297773 critical splice donor site probably benign
R1760:Cngb1 UTSW 8 95299700 missense probably benign 0.03
R1833:Cngb1 UTSW 8 95242355 missense probably damaging 1.00
R1935:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R1939:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R1940:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R2045:Cngb1 UTSW 8 95297085 splice site probably null
R2379:Cngb1 UTSW 8 95260130 missense probably damaging 1.00
R2940:Cngb1 UTSW 8 95252107 missense probably benign 0.44
R4034:Cngb1 UTSW 8 95264450 missense possibly damaging 0.47
R4058:Cngb1 UTSW 8 95267654 missense probably benign 0.00
R4425:Cngb1 UTSW 8 95299716 missense probably damaging 1.00
R4585:Cngb1 UTSW 8 95297128 critical splice acceptor site probably null
R4591:Cngb1 UTSW 8 95253384 missense probably damaging 1.00
R4638:Cngb1 UTSW 8 95266019 missense probably damaging 1.00
R4906:Cngb1 UTSW 8 95251973 missense probably damaging 0.96
R4950:Cngb1 UTSW 8 95248507 missense probably damaging 1.00
R4979:Cngb1 UTSW 8 95259157 missense probably damaging 0.99
R5148:Cngb1 UTSW 8 95265983 missense probably benign 0.28
R5474:Cngb1 UTSW 8 95251969 missense probably damaging 1.00
R5475:Cngb1 UTSW 8 95251969 missense probably damaging 1.00
R5545:Cngb1 UTSW 8 95252173 missense
R5585:Cngb1 UTSW 8 95263139 missense probably damaging 1.00
R5637:Cngb1 UTSW 8 95257921 missense probably damaging 1.00
R5785:Cngb1 UTSW 8 95254195 missense possibly damaging 0.90
R5967:Cngb1 UTSW 8 95251906 missense probably damaging 1.00
R6013:Cngb1 UTSW 8 95284321 unclassified probably benign
R6049:Cngb1 UTSW 8 95270842 missense probably damaging 0.99
R6370:Cngb1 UTSW 8 95264422 missense probably benign 0.33
R6377:Cngb1 UTSW 8 95248980 missense probably damaging 1.00
R6401:Cngb1 UTSW 8 95303739 unclassified probably benign
R6427:Cngb1 UTSW 8 95297759 intron probably benign
R6492:Cngb1 UTSW 8 95264424 missense probably benign 0.01
R6613:Cngb1 UTSW 8 95266010 missense possibly damaging 0.95
R6721:Cngb1 UTSW 8 95270888 missense probably benign 0.05
R6919:Cngb1 UTSW 8 95248375 missense probably null 1.00
R7012:Cngb1 UTSW 8 95257955 missense possibly damaging 0.83
R7418:Cngb1 UTSW 8 95278259 nonsense probably null
R7464:Cngb1 UTSW 8 95254183 missense possibly damaging 0.92
R7806:Cngb1 UTSW 8 95298804 critical splice donor site probably null
R8048:Cngb1 UTSW 8 95263210 missense possibly damaging 0.90
R8074:Cngb1 UTSW 8 95252173 missense
R8189:Cngb1 UTSW 8 95303620 unclassified probably benign
R8245:Cngb1 UTSW 8 95297780 missense unknown
R8286:Cngb1 UTSW 8 95275624 missense
RF010:Cngb1 UTSW 8 95303650 frame shift probably null
T0722:Cngb1 UTSW 8 95296650 missense probably benign 0.02
T0722:Cngb1 UTSW 8 95297819 missense probably damaging 0.99
T0722:Cngb1 UTSW 8 95303696 unclassified probably benign
T0722:Cngb1 UTSW 8 95303714 unclassified probably benign
Z1177:Cngb1 UTSW 8 95252136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGACCACATTTCCCACTG -3'
(R):5'- AAGACTATGTTGCTTACAGGTGTC -3'

Sequencing Primer
(F):5'- ACATTTCCCACTGGCCCC -3'
(R):5'- TGCTTACAGGTGTCAGGATG -3'
Posted On2019-12-04