Incidental Mutation 'RF053:Bmp5'
ID605185
Institutional Source Beutler Lab
Gene Symbol Bmp5
Ensembl Gene ENSMUSG00000032179
Gene Namebone morphogenetic protein 5
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #RF053 (G1)
Quality Score214.472
Status Not validated
Chromosome9
Chromosomal Location75775364-75900310 bp(+) (GRCm38)
Type of Mutationsmall deletion (2 aa in frame mutation)
DNA Base Change (assembly) TGAGGAG to T at 75776374 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000012281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012281]
Predicted Effect probably benign
Transcript: ENSMUST00000012281
SMART Domains Protein: ENSMUSP00000012281
Gene: ENSMUSG00000032179

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TGFb_propeptide 31 304 5.2e-94 PFAM
low complexity region 316 331 N/A INTRINSIC
TGFB 353 454 3.54e-69 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone and cartilage development. Mice with null mutations in this gene exhibit a short ear phenotype, which is characterized by reduced size of the external ear, altered size and shape of the sternum, and other skeletal and soft-tissue abnormalities. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous recessive mutants have shortened, slightly ruffled external ears due to a defective cartilage framework affecting the whole skeleton; a series of genomic deletions of the region cause embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
Abra TGGC T 15: 41,866,299 probably benign Het
Blm CTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTC 7: 80,512,921 probably benign Het
Cngb1 GGCTCTGGCTCTGGCTCTGGCTCTG GG 8: 95,303,648 probably null Het
Cyb5r4 GGATGTGACAGACACACTGCCCAG GGATGTGACAGACACACTGCCCAGCGATGTGACAGACACACTGCCCAG 9: 87,040,422 probably benign Het
Ehbp1l1 TCACACCACC T 19: 5,716,002 probably benign Het
Kdm3a TTTTT TTTTTT 6: 71,632,049 probably benign Het
Krtap28-10 CAGCCACCACAGC CAGCCACCACAGCCAAAGCCACCACAGC 1: 83,042,278 probably benign Het
Mamld1 CA CAGAA X: 71,118,852 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,290 probably benign Het
Med12l CAG CAGAAG 3: 59,275,993 probably benign Het
Nefh GACTTGGCCTCACCT GACTTGGCCTCACCTCACCACTTGGCCTCACCT 11: 4,941,014 probably null Het
Rap1gds1 TCATTTATTATGACCATAC TC 3: 138,941,657 probably null Het
Tcof1 C CAGA 18: 60,835,747 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,114 probably benign Het
Trappc9 TGCT TGCTGCTGCTGCTGCGGCT 15: 72,801,328 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTAA 9: 44,089,129 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Zfp69 GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGATGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC 4: 120,947,347 probably benign Het
Znrd1as CACCAC CACCACCACCACCACCACCTCTACCAC 17: 36,965,066 probably benign Het
Other mutations in Bmp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Bmp5 APN 9 75839613 missense probably damaging 1.00
IGL02096:Bmp5 APN 9 75898551 missense probably damaging 1.00
IGL02977:Bmp5 APN 9 75893799 missense probably damaging 1.00
FR4976:Bmp5 UTSW 9 75776375 small deletion probably benign
R1291:Bmp5 UTSW 9 75886673 nonsense probably null
R1679:Bmp5 UTSW 9 75839595 missense probably benign
R2049:Bmp5 UTSW 9 75893790 missense probably damaging 1.00
R2278:Bmp5 UTSW 9 75776548 missense possibly damaging 0.90
R5159:Bmp5 UTSW 9 75893753 missense probably damaging 1.00
R5431:Bmp5 UTSW 9 75893709 missense probably damaging 1.00
R5756:Bmp5 UTSW 9 75776367 missense probably benign
R5884:Bmp5 UTSW 9 75898554 missense probably damaging 1.00
R6749:Bmp5 UTSW 9 75776093 start codon destroyed probably benign 0.00
R7346:Bmp5 UTSW 9 75873360 missense probably damaging 1.00
R7522:Bmp5 UTSW 9 75776102 missense probably benign
R7736:Bmp5 UTSW 9 75893790 missense probably damaging 1.00
R8226:Bmp5 UTSW 9 75776324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCTTGGGAGACAATCAC -3'
(R):5'- AAGCTCATGACCATGTCAGCATC -3'

Sequencing Primer
(F):5'- TTGGGAGACAATCACGTTCACTC -3'
(R):5'- TGACCATGTCAGCATCATTCAG -3'
Posted On2019-12-04