Incidental Mutation 'RF053:Abra'
ID605188
Institutional Source Beutler Lab
Gene Symbol Abra
Ensembl Gene ENSMUSG00000042895
Gene Nameactin-binding Rho activating protein
SynonymsSTARS, C130068O12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #RF053 (G1)
Quality Score217.468
Status Not validated
Chromosome15
Chromosomal Location41864076-41869720 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TGGC to T at 41866299 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054742]
Predicted Effect probably benign
Transcript: ENSMUST00000054742
SMART Domains Protein: ENSMUSP00000051973
Gene: ENSMUSG00000042895

DomainStartEndE-ValueType
Costars 298 374 6.22e-45 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired arteriogenesis following occlusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
Blm CTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTC 7: 80,512,921 probably benign Het
Bmp5 TGAGGAG T 9: 75,776,374 probably benign Het
Cngb1 GGCTCTGGCTCTGGCTCTGGCTCTG GG 8: 95,303,648 probably null Het
Cyb5r4 GGATGTGACAGACACACTGCCCAG GGATGTGACAGACACACTGCCCAGCGATGTGACAGACACACTGCCCAG 9: 87,040,422 probably benign Het
Ehbp1l1 TCACACCACC T 19: 5,716,002 probably benign Het
Kdm3a TTTTT TTTTTT 6: 71,632,049 probably benign Het
Krtap28-10 CAGCCACCACAGC CAGCCACCACAGCCAAAGCCACCACAGC 1: 83,042,278 probably benign Het
Mamld1 CA CAGAA X: 71,118,852 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,290 probably benign Het
Med12l CAG CAGAAG 3: 59,275,993 probably benign Het
Nefh GACTTGGCCTCACCT GACTTGGCCTCACCTCACCACTTGGCCTCACCT 11: 4,941,014 probably null Het
Rap1gds1 TCATTTATTATGACCATAC TC 3: 138,941,657 probably null Het
Tcof1 C CAGA 18: 60,835,747 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,114 probably benign Het
Trappc9 TGCT TGCTGCTGCTGCTGCGGCT 15: 72,801,328 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTAA 9: 44,089,129 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Zfp69 GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGATGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC 4: 120,947,347 probably benign Het
Znrd1as CACCAC CACCACCACCACCACCACCTCTACCAC 17: 36,965,066 probably benign Het
Other mutations in Abra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Abra APN 15 41866017 missense probably damaging 0.99
IGL02022:Abra APN 15 41869406 missense probably benign
IGL02370:Abra APN 15 41869244 missense probably damaging 1.00
IGL02406:Abra APN 15 41869187 missense probably damaging 1.00
R1860:Abra UTSW 15 41869034 missense probably damaging 1.00
R1861:Abra UTSW 15 41869034 missense probably damaging 1.00
R2385:Abra UTSW 15 41869353 missense probably damaging 0.97
R3718:Abra UTSW 15 41866293 missense probably benign
R4582:Abra UTSW 15 41869285 missense probably benign 0.16
R4621:Abra UTSW 15 41869224 missense probably benign 0.10
R4724:Abra UTSW 15 41865906 missense probably damaging 1.00
R5926:Abra UTSW 15 41866254 missense probably damaging 1.00
R6417:Abra UTSW 15 41866056 missense probably benign 0.01
R6649:Abra UTSW 15 41869233 missense probably benign
R7348:Abra UTSW 15 41866159 missense probably damaging 1.00
R7487:Abra UTSW 15 41869553 missense probably damaging 1.00
R7997:Abra UTSW 15 41866197 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATAGATGTGCTCTTCCGC -3'
(R):5'- GCTTGAGTTTAATATCACTAGTGGC -3'

Sequencing Primer
(F):5'- GCTCGCTTGGCCCTTTCAG -3'
(R):5'- ACAGAGACTACACATGGG -3'
Posted On2019-12-04