Incidental Mutation 'RF054:Thbs1'
Institutional Source Beutler Lab
Gene Symbol Thbs1
Ensembl Gene ENSMUSG00000040152
Gene Namethrombospondin 1
SynonymsTSP-1, TSP1, tbsp1, Thbs-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF054 (G1)
Quality Score214.458
Status Not validated
Chromosomal Location118111876-118127133 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) TGACCTTAG to TG at 118122865 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039559]
Predicted Effect probably benign
Transcript: ENSMUST00000039559
SMART Domains Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152

signal peptide 1 18 N/A INTRINSIC
TSPN 24 221 2.68e-60 SMART
low complexity region 237 249 N/A INTRINSIC
coiled coil region 292 315 N/A INTRINSIC
VWC 319 373 3.6e-20 SMART
TSP1 383 430 4.21e-12 SMART
TSP1 439 491 3.04e-18 SMART
TSP1 496 548 8.6e-18 SMART
EGF 551 588 3.88e-3 SMART
EGF 592 646 1.69e1 SMART
EGF 650 691 7.13e-2 SMART
Pfam:TSP_3 728 763 5.8e-12 PFAM
Pfam:TSP_3 763 786 2.1e-5 PFAM
Pfam:TSP_3 787 822 3.3e-13 PFAM
Pfam:TSP_3 822 845 1.1e-6 PFAM
Pfam:TSP_3 846 883 2e-15 PFAM
Pfam:TSP_3 884 919 8.3e-13 PFAM
Pfam:TSP_3 920 954 4.9e-10 PFAM
Pfam:TSP_C 973 1170 1.4e-99 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 CGGC CGGCGGAGGC 18: 36,560,929 probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,299,938 probably benign Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm8369 GTGT GTGTCTGT 19: 11,511,764 probably null Het
Lce1m CAC CACCGCTGCGGCGAC 3: 93,018,298 probably benign Het
Lrmp ATTG ATTGAGCACTTTG 6: 145,173,788 probably benign Het
Nefh GGGACT GGGACTGGGCCTCACCTGCGGACT 11: 4,941,048 probably benign Het
Six3 GCG GCGCCG 17: 85,621,355 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tob1 GCA GCACCA 11: 94,214,461 probably benign Het
Ubqln3 AACAC A 7: 104,141,178 probably null Het
Zfhx3 AACAGCAGC AACAGCAGCCACAGCAGC 8: 108,956,096 probably benign Het
Other mutations in Thbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Thbs1 APN 2 118122973 missense probably damaging 1.00
IGL00920:Thbs1 APN 2 118113201 missense probably damaging 0.99
IGL01295:Thbs1 APN 2 118118327 missense possibly damaging 0.88
IGL01649:Thbs1 APN 2 118114982 missense probably benign
IGL02077:Thbs1 APN 2 118113110 missense probably benign 0.00
IGL02251:Thbs1 APN 2 118113518 missense probably benign 0.00
IGL02263:Thbs1 APN 2 118119880 missense probably benign 0.06
IGL02392:Thbs1 APN 2 118114660 missense probably benign
IGL02393:Thbs1 APN 2 118123099 missense possibly damaging 0.87
IGL02411:Thbs1 APN 2 118114970 missense probably benign
IGL02659:Thbs1 APN 2 118114792 missense probably benign 0.29
Stark UTSW 2 118121237 critical splice donor site probably null
R0014:Thbs1 UTSW 2 118113350 missense possibly damaging 0.51
R0042:Thbs1 UTSW 2 118122877 missense probably damaging 1.00
R0064:Thbs1 UTSW 2 118123914 critical splice acceptor site probably null
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0316:Thbs1 UTSW 2 118117574 missense probably damaging 1.00
R0393:Thbs1 UTSW 2 118112991 missense possibly damaging 0.69
R0678:Thbs1 UTSW 2 118122906 missense probably damaging 1.00
R1037:Thbs1 UTSW 2 118123051 missense probably damaging 1.00
R1440:Thbs1 UTSW 2 118114355 missense probably damaging 1.00
R1454:Thbs1 UTSW 2 118122672 missense probably damaging 1.00
R1571:Thbs1 UTSW 2 118119197 missense probably damaging 0.99
R1702:Thbs1 UTSW 2 118113442 missense probably benign
R2035:Thbs1 UTSW 2 118118340 critical splice donor site probably null
R2068:Thbs1 UTSW 2 118123537 nonsense probably null
R2171:Thbs1 UTSW 2 118122579 missense probably damaging 1.00
R2844:Thbs1 UTSW 2 118117628 missense probably benign 0.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R3620:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3621:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3726:Thbs1 UTSW 2 118114710 missense probably benign 0.02
R4499:Thbs1 UTSW 2 118119950 missense possibly damaging 0.82
R4524:Thbs1 UTSW 2 118122979 missense probably damaging 1.00
R4576:Thbs1 UTSW 2 118119416 missense probably damaging 0.97
R4596:Thbs1 UTSW 2 118114755 missense possibly damaging 0.80
R4646:Thbs1 UTSW 2 118118329 missense probably benign 0.15
R4783:Thbs1 UTSW 2 118114792 missense probably benign 0.04
R4836:Thbs1 UTSW 2 118115018 missense possibly damaging 0.91
R4943:Thbs1 UTSW 2 118113449 missense probably damaging 1.00
R4967:Thbs1 UTSW 2 118114778 missense probably benign
R5014:Thbs1 UTSW 2 118120037 critical splice donor site probably null
R5062:Thbs1 UTSW 2 118121237 critical splice donor site probably null
R5363:Thbs1 UTSW 2 118122666 missense probably damaging 1.00
R5420:Thbs1 UTSW 2 118113155 missense possibly damaging 0.83
R5432:Thbs1 UTSW 2 118114683 missense probably benign 0.25
R5788:Thbs1 UTSW 2 118122508 missense probably damaging 1.00
R6221:Thbs1 UTSW 2 118119997 missense probably damaging 1.00
R6327:Thbs1 UTSW 2 118112656 missense unknown
R6466:Thbs1 UTSW 2 118119847 missense probably damaging 1.00
R6480:Thbs1 UTSW 2 118119117 missense probably damaging 1.00
R6794:Thbs1 UTSW 2 118120038 splice site probably null
R6983:Thbs1 UTSW 2 118119952 missense probably damaging 1.00
R7284:Thbs1 UTSW 2 118119356 missense probably damaging 1.00
R7320:Thbs1 UTSW 2 118114957 missense possibly damaging 0.80
R7467:Thbs1 UTSW 2 118118200 missense probably damaging 1.00
R7542:Thbs1 UTSW 2 118121174 missense probably damaging 1.00
R7552:Thbs1 UTSW 2 118113362 missense possibly damaging 0.90
R7575:Thbs1 UTSW 2 118122928 missense probably damaging 1.00
R7870:Thbs1 UTSW 2 118115027 missense possibly damaging 0.46
R7953:Thbs1 UTSW 2 118115027 missense possibly damaging 0.46
RF039:Thbs1 UTSW 2 118122865 critical splice acceptor site probably benign
X0019:Thbs1 UTSW 2 118112982 missense probably damaging 1.00
Z1176:Thbs1 UTSW 2 118113479 missense probably benign 0.34
Z1176:Thbs1 UTSW 2 118120977 missense probably benign 0.25
Z1176:Thbs1 UTSW 2 118122922 missense probably damaging 1.00
Z1177:Thbs1 UTSW 2 118117658 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04