Incidental Mutation 'RF054:Dmkn'
ID 605204
Institutional Source Beutler Lab
Gene Symbol Dmkn
Ensembl Gene ENSMUSG00000060962
Gene Name dermokine
Synonyms sk30, 1110014F24Rik, sk89, Dmkn, cI-36, dermokine
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # RF054 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 30763756-30781063 bp(+) (GRCm38)
Type of Mutation small insertion (9 aa in frame mutation)
DNA Base Change (assembly) GAAGTGGTGGAAGTGGTGG to GAAGTGGTGGAAGTGGTGGAAGTGGTGTAAGTGGTGGAAGTGGTGG at 30767188 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054427] [ENSMUST00000085688] [ENSMUST00000085691] [ENSMUST00000165887] [ENSMUST00000188578]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054427
SMART Domains Protein: ENSMUSP00000060362
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 5.96e-5 PROSPERO
internal_repeat_2 25 53 3.87e-5 PROSPERO
internal_repeat_2 45 73 3.87e-5 PROSPERO
internal_repeat_3 65 94 5.96e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 312 331 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
internal_repeat_1 387 414 3.28e-7 PROSPERO
internal_repeat_1 422 449 3.28e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000085688
SMART Domains Protein: ENSMUSP00000082831
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 6.61e-5 PROSPERO
internal_repeat_2 25 53 4.31e-5 PROSPERO
internal_repeat_2 45 73 4.31e-5 PROSPERO
internal_repeat_3 65 94 6.61e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 308 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
internal_repeat_1 363 390 3.84e-7 PROSPERO
internal_repeat_1 398 425 3.84e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000085691
SMART Domains Protein: ENSMUSP00000082834
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 6.12e-5 PROSPERO
internal_repeat_2 25 53 3.97e-5 PROSPERO
internal_repeat_2 45 73 3.97e-5 PROSPERO
internal_repeat_3 65 94 6.12e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 338 350 N/A INTRINSIC
internal_repeat_1 378 405 3.43e-7 PROSPERO
internal_repeat_1 413 440 3.43e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000165887
SMART Domains Protein: ENSMUSP00000129031
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_2 25 53 9.56e-5 PROSPERO
internal_repeat_2 45 73 9.56e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
internal_repeat_1 394 421 1.01e-6 PROSPERO
internal_repeat_1 429 456 1.01e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000188578
SMART Domains Protein: ENSMUSP00000140196
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
low complexity region 5 102 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
internal_repeat_1 173 200 3.77e-7 PROSPERO
internal_repeat_1 208 235 3.77e-7 PROSPERO
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 CGGC CGGCGGAGGC 18: 36,560,929 probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Dnmt1 CCTCGTT CCTCGTTTTGGGGGCGGAGCACAGTTCCTAGCTCGTT 9: 20,910,139 probably null Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,299,938 probably benign Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm8369 GTGT GTGTCTGT 19: 11,511,764 probably null Het
Lce1m CAC CACCGCTGCGGCGAC 3: 93,018,298 probably benign Het
Lrmp ATTG ATTGAGCACTTTG 6: 145,173,788 probably benign Het
Lypd8 TC TCGCCTCTGTTACCCCACAAATCACCAACACCTCCCCC 11: 58,390,251 probably benign Het
Nefh GGGACT GGGACTGGGCCTCACCTGCGGACT 11: 4,941,048 probably benign Het
Prp2 CTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCT C 6: 132,600,521 probably null Het
Rassf6 TCACTCATGGTCCTGTAGAGCAATGGGGATTC TCACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCCCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,911 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 CAATGGGGATTC CAATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGAAATGGGGATTC 5: 90,608,931 probably benign Het
Sbp GATGCTGACAACAAA GATGCTGACAACAAATATGCTGACAACAAA 17: 23,945,371 probably benign Het
Six3 GCG GCGCCG 17: 85,621,355 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Thbs1 TGACCTTAG TG 2: 118,122,865 probably benign Het
Tob1 GCA GCACCA 11: 94,214,461 probably benign Het
Ubqln3 AACAC A 7: 104,141,178 probably null Het
Zfhx3 AACAGCAGC AACAGCAGCCACAGCAGC 8: 108,956,096 probably benign Het
Other mutations in Dmkn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Dmkn APN 7 30778270 critical splice donor site probably null
IGL03084:Dmkn APN 7 30771056 missense possibly damaging 0.82
IGL03376:Dmkn APN 7 30771242 missense possibly damaging 0.92
R0077:Dmkn UTSW 7 30765294 missense probably benign 0.00
R0718:Dmkn UTSW 7 30764786 unclassified probably benign
R0892:Dmkn UTSW 7 30767404 missense probably damaging 1.00
R1163:Dmkn UTSW 7 30765051 missense probably damaging 1.00
R1858:Dmkn UTSW 7 30764565 missense probably benign 0.08
R2915:Dmkn UTSW 7 30765316 missense unknown
R4705:Dmkn UTSW 7 30763981 missense probably damaging 1.00
R4806:Dmkn UTSW 7 30771242 missense possibly damaging 0.92
R4921:Dmkn UTSW 7 30771233 missense probably damaging 0.99
R5031:Dmkn UTSW 7 30764236 missense probably benign 0.09
R5056:Dmkn UTSW 7 30764104 missense probably damaging 1.00
R5577:Dmkn UTSW 7 30764546 missense probably damaging 1.00
R5780:Dmkn UTSW 7 30777615 missense probably damaging 1.00
R6233:Dmkn UTSW 7 30779679 missense probably damaging 0.99
R6504:Dmkn UTSW 7 30776429 missense possibly damaging 0.82
R7383:Dmkn UTSW 7 30765368 missense unknown
R7526:Dmkn UTSW 7 30777651 missense possibly damaging 0.90
R7667:Dmkn UTSW 7 30777609 missense probably damaging 1.00
R8790:Dmkn UTSW 7 30764024 missense probably benign 0.33
R9792:Dmkn UTSW 7 30765420 missense unknown
RF007:Dmkn UTSW 7 30769704 splice site probably null
RF022:Dmkn UTSW 7 30767175 small insertion probably benign
RF027:Dmkn UTSW 7 30767194 small insertion probably benign
RF030:Dmkn UTSW 7 30767182 small insertion probably benign
RF032:Dmkn UTSW 7 30767182 small insertion probably benign
RF038:Dmkn UTSW 7 30767194 small insertion probably benign
RF041:Dmkn UTSW 7 30767173 small insertion probably benign
RF055:Dmkn UTSW 7 30767191 small insertion probably benign
RF056:Dmkn UTSW 7 30767207 small insertion probably benign
RF057:Dmkn UTSW 7 30767188 small insertion probably benign
RF062:Dmkn UTSW 7 30767175 small insertion probably benign
X0067:Dmkn UTSW 7 30778227 missense possibly damaging 0.86
Z1176:Dmkn UTSW 7 30776497 missense possibly damaging 0.82
Z1186:Dmkn UTSW 7 30765393 small deletion probably benign
Z1186:Dmkn UTSW 7 30765401 small deletion probably benign
Z1186:Dmkn UTSW 7 30767171 small insertion probably benign
Z1186:Dmkn UTSW 7 30767174 small insertion probably benign
Z1186:Dmkn UTSW 7 30767177 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTATTTTCAAAGCCTGGGCCAG -3'
(R):5'- ATCATTCCCTGGGTTGTTACAC -3'

Sequencing Primer
(F):5'- GGCCTGGCCTTCTATTGCTG -3'
(R):5'- CATTCCCTGGGTTGTTACACTGTAG -3'
Posted On 2019-12-04