Incidental Mutation 'RF054:Dnmt1'
ID 605208
Institutional Source Beutler Lab
Gene Symbol Dnmt1
Ensembl Gene ENSMUSG00000004099
Gene Name DNA methyltransferase 1
Synonyms MTase, Dnmt1o, Cxxc9, MommeD2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF054 (G1)
Quality Score 217.468
Status Not validated
Chromosome 9
Chromosomal Location 20818501-20871084 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) CCTCGTT to CCTCGTTTTGGGGGCGGAGCACAGTTCCTAGCTCGTT at 20821435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004202] [ENSMUST00000177754] [ENSMUST00000178110] [ENSMUST00000216540]
AlphaFold P13864
Predicted Effect probably null
Transcript: ENSMUST00000004202
SMART Domains Protein: ENSMUSP00000004202
Gene: ENSMUSG00000004099

DomainStartEndE-ValueType
DMAP_binding 16 106 1.7e-13 SMART
low complexity region 121 143 N/A INTRINSIC
low complexity region 156 166 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 306 328 N/A INTRINSIC
Pfam:DNMT1-RFD 405 540 4.8e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Pfam:zf-CXXC 648 694 2.7e-17 PFAM
low complexity region 701 711 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
BAH 758 884 4.62e-31 SMART
BAH 935 1103 1.79e-37 SMART
low complexity region 1110 1124 N/A INTRINSIC
Pfam:DNA_methylase 1142 1596 1.3e-49 PFAM
low complexity region 1600 1619 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177754
SMART Domains Protein: ENSMUSP00000136982
Gene: ENSMUSG00000004099

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
Pfam:DNMT1-RFD 286 421 3.4e-40 PFAM
low complexity region 491 506 N/A INTRINSIC
Pfam:zf-CXXC 529 575 2.3e-17 PFAM
low complexity region 582 592 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
BAH 639 765 4.62e-31 SMART
BAH 816 984 1.79e-37 SMART
low complexity region 991 1005 N/A INTRINSIC
Pfam:DNA_methylase 1023 1477 1.3e-49 PFAM
low complexity region 1481 1500 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178110
SMART Domains Protein: ENSMUSP00000136669
Gene: ENSMUSG00000004099

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 38 48 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
Pfam:DNMT1-RFD 287 422 2.6e-40 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:zf-CXXC 530 576 4.7e-17 PFAM
low complexity region 583 593 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
BAH 640 766 4.62e-31 SMART
BAH 817 985 1.79e-37 SMART
low complexity region 992 1006 N/A INTRINSIC
Pfam:DNA_methylase 1024 1478 8e-50 PFAM
low complexity region 1482 1501 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000216540
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a methyltransferase that preferentially methylates cytosines of CpG residues in hemimethylated DNA to generate fully methylated CpG base pairs during DNA replication. This enzyme plays roles in diverse cellular processes including cell cycle regulation, DNA repair, and telomere maintenance. The encoded protein is composed of an N-terminal domain with a nuclear localization sequence and replication fork-targeting domain, a DNA-binding CXXC domain, two bromo-adjacent homology domains, and a C-terminal catalytic domain. Mouse embryonic stem cells mutant for this gene are viable, but when introduced into the germ line, cause a recessive lethal phenotype with mutant embryos displaying stunted growth and developmental defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations causing partial or severe loss of function were homozygous lethal by embryonic day 9.5, with lack of appropriate genomic imprinting observed at several loci. [provided by MGI curators]
Allele List at MGI

All alleles(109) : Targeted, knock-out(5) Targeted, other(11) Gene trapped(92) Chemically induced(1)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 CGGC CGGCGGAGGC 18: 36,693,982 (GRCm39) probably benign Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 119,963,794 (GRCm39) probably benign Het
Chga AGC AGCTGC 12: 102,527,682 (GRCm39) probably benign Het
Dmkn GAAGTGGTGGAAGTGGTGG GAAGTGGTGGAAGTGGTGGAAGTGGTGTAAGTGGTGGAAGTGGTGG 7: 30,466,613 (GRCm39) probably benign Het
Epha8 CCTGGGC CC 4: 136,660,348 (GRCm39) probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,433,010 (GRCm39) probably benign Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Gm8369 GTGT GTGTCTGT 19: 11,489,128 (GRCm39) probably null Het
Irag2 ATTG ATTGAGCACTTTG 6: 145,119,514 (GRCm39) probably benign Het
Lce1m CAC CACCGCTGCGGCGAC 3: 92,925,605 (GRCm39) probably benign Het
Lypd8 TC TCGCCTCTGTTACCCCACAAATCACCAACACCTCCCCC 11: 58,281,077 (GRCm39) probably benign Het
Nefh GGGACT GGGACTGGGCCTCACCTGCGGACT 11: 4,891,048 (GRCm39) probably benign Het
Prp2 CTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCT C 6: 132,577,484 (GRCm39) probably null Het
Rassf6 TCACTCATGGTCCTGTAGAGCAATGGGGATTC TCACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCCCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,756,770 (GRCm39) probably benign Het
Rassf6 CAATGGGGATTC CAATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGAAATGGGGATTC 5: 90,756,790 (GRCm39) probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,756,783 (GRCm39) probably benign Het
Sbp GATGCTGACAACAAA GATGCTGACAACAAATATGCTGACAACAAA 17: 24,164,345 (GRCm39) probably benign Het
Six3 GCG GCGCCG 17: 85,928,783 (GRCm39) probably benign Het
Tfeb CAG CAGTAG 17: 48,097,023 (GRCm39) probably null Het
Thbs1 TGACCTTAG TG 2: 117,953,346 (GRCm39) probably benign Het
Tob1 GCA GCACCA 11: 94,105,287 (GRCm39) probably benign Het
Ubqln3 AACAC A 7: 103,790,385 (GRCm39) probably null Het
Zfhx3 AACAGCAGC AACAGCAGCCACAGCAGC 8: 109,682,728 (GRCm39) probably benign Het
Other mutations in Dnmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dnmt1 APN 9 20,821,566 (GRCm39) missense possibly damaging 0.94
IGL01093:Dnmt1 APN 9 20,821,081 (GRCm39) missense possibly damaging 0.88
IGL01160:Dnmt1 APN 9 20,828,615 (GRCm39) missense possibly damaging 0.90
IGL01704:Dnmt1 APN 9 20,821,476 (GRCm39) missense probably damaging 1.00
IGL02105:Dnmt1 APN 9 20,819,178 (GRCm39) missense unknown
IGL02124:Dnmt1 APN 9 20,819,845 (GRCm39) missense probably damaging 1.00
IGL02188:Dnmt1 APN 9 20,853,034 (GRCm39) nonsense probably null
IGL02409:Dnmt1 APN 9 20,837,793 (GRCm39) missense probably benign 0.00
IGL02579:Dnmt1 APN 9 20,829,416 (GRCm39) missense possibly damaging 0.79
IGL02625:Dnmt1 APN 9 20,838,442 (GRCm39) missense probably benign 0.01
IGL02794:Dnmt1 APN 9 20,847,847 (GRCm39) missense probably benign
IGL02795:Dnmt1 APN 9 20,838,407 (GRCm39) missense probably benign 0.12
IGL02938:Dnmt1 APN 9 20,852,669 (GRCm39) missense probably benign 0.23
IGL03245:Dnmt1 APN 9 20,827,056 (GRCm39) missense probably damaging 0.99
IGL03303:Dnmt1 APN 9 20,838,006 (GRCm39) missense probably benign
Blankslate UTSW 9 20,823,521 (GRCm39) missense possibly damaging 0.86
Midrash UTSW 9 20,821,089 (GRCm39) nonsense probably null
Rashi UTSW 9 20,833,408 (GRCm39) missense possibly damaging 0.94
B5639:Dnmt1 UTSW 9 20,819,264 (GRCm39) splice site probably benign
BB003:Dnmt1 UTSW 9 20,818,855 (GRCm39) missense unknown
BB013:Dnmt1 UTSW 9 20,818,855 (GRCm39) missense unknown
PIT4576001:Dnmt1 UTSW 9 20,823,071 (GRCm39) missense probably benign 0.28
R0071:Dnmt1 UTSW 9 20,819,916 (GRCm39) missense probably damaging 0.99
R0180:Dnmt1 UTSW 9 20,819,916 (GRCm39) missense probably damaging 0.99
R0368:Dnmt1 UTSW 9 20,853,053 (GRCm39) missense probably damaging 0.99
R0387:Dnmt1 UTSW 9 20,829,509 (GRCm39) missense probably damaging 1.00
R0529:Dnmt1 UTSW 9 20,822,846 (GRCm39) missense probably damaging 1.00
R0532:Dnmt1 UTSW 9 20,829,852 (GRCm39) splice site probably benign
R0612:Dnmt1 UTSW 9 20,829,489 (GRCm39) missense probably damaging 0.98
R1109:Dnmt1 UTSW 9 20,833,684 (GRCm39) missense probably damaging 1.00
R1298:Dnmt1 UTSW 9 20,852,752 (GRCm39) missense probably benign
R1345:Dnmt1 UTSW 9 20,819,814 (GRCm39) missense probably damaging 1.00
R1472:Dnmt1 UTSW 9 20,843,472 (GRCm39) missense probably benign 0.28
R1654:Dnmt1 UTSW 9 20,847,870 (GRCm39) missense possibly damaging 0.75
R1817:Dnmt1 UTSW 9 20,838,422 (GRCm39) missense probably benign
R1836:Dnmt1 UTSW 9 20,829,542 (GRCm39) missense probably damaging 1.00
R1957:Dnmt1 UTSW 9 20,838,442 (GRCm39) missense probably benign 0.01
R1958:Dnmt1 UTSW 9 20,838,442 (GRCm39) missense probably benign 0.01
R2097:Dnmt1 UTSW 9 20,821,084 (GRCm39) missense probably benign 0.00
R2145:Dnmt1 UTSW 9 20,848,451 (GRCm39) splice site probably benign
R2326:Dnmt1 UTSW 9 20,835,442 (GRCm39) splice site probably benign
R4199:Dnmt1 UTSW 9 20,849,414 (GRCm39) missense probably benign 0.00
R4456:Dnmt1 UTSW 9 20,821,138 (GRCm39) missense probably damaging 1.00
R4518:Dnmt1 UTSW 9 20,823,274 (GRCm39) missense probably benign 0.00
R4586:Dnmt1 UTSW 9 20,837,989 (GRCm39) missense probably benign 0.05
R4836:Dnmt1 UTSW 9 20,819,854 (GRCm39) missense probably damaging 1.00
R5014:Dnmt1 UTSW 9 20,823,550 (GRCm39) missense probably benign 0.07
R5338:Dnmt1 UTSW 9 20,864,015 (GRCm39) missense probably benign 0.44
R5385:Dnmt1 UTSW 9 20,829,776 (GRCm39) missense probably damaging 1.00
R5579:Dnmt1 UTSW 9 20,831,501 (GRCm39) missense probably damaging 1.00
R5645:Dnmt1 UTSW 9 20,833,443 (GRCm39) missense probably damaging 1.00
R5719:Dnmt1 UTSW 9 20,823,891 (GRCm39) missense possibly damaging 0.86
R5881:Dnmt1 UTSW 9 20,864,013 (GRCm39) missense probably damaging 0.97
R6039:Dnmt1 UTSW 9 20,837,716 (GRCm39) intron probably benign
R6039:Dnmt1 UTSW 9 20,837,716 (GRCm39) intron probably benign
R6143:Dnmt1 UTSW 9 20,838,430 (GRCm39) missense probably benign 0.30
R6342:Dnmt1 UTSW 9 20,821,089 (GRCm39) nonsense probably null
R6374:Dnmt1 UTSW 9 20,835,341 (GRCm39) missense possibly damaging 0.73
R6953:Dnmt1 UTSW 9 20,829,822 (GRCm39) missense probably benign
R6990:Dnmt1 UTSW 9 20,827,110 (GRCm39) nonsense probably null
R7089:Dnmt1 UTSW 9 20,819,785 (GRCm39) missense probably damaging 0.99
R7463:Dnmt1 UTSW 9 20,823,521 (GRCm39) missense possibly damaging 0.86
R7522:Dnmt1 UTSW 9 20,831,498 (GRCm39) missense probably damaging 0.99
R7695:Dnmt1 UTSW 9 20,825,281 (GRCm39) missense probably null 1.00
R7785:Dnmt1 UTSW 9 20,833,345 (GRCm39) missense probably damaging 0.98
R7926:Dnmt1 UTSW 9 20,818,855 (GRCm39) missense unknown
R8037:Dnmt1 UTSW 9 20,852,860 (GRCm39) missense probably damaging 0.99
R8038:Dnmt1 UTSW 9 20,852,860 (GRCm39) missense probably damaging 0.99
R8424:Dnmt1 UTSW 9 20,829,836 (GRCm39) missense probably benign 0.07
R8692:Dnmt1 UTSW 9 20,853,077 (GRCm39) missense probably damaging 1.00
R9016:Dnmt1 UTSW 9 20,847,855 (GRCm39) missense possibly damaging 0.67
R9101:Dnmt1 UTSW 9 20,852,839 (GRCm39) missense probably damaging 1.00
R9200:Dnmt1 UTSW 9 20,819,896 (GRCm39) missense probably benign 0.00
R9248:Dnmt1 UTSW 9 20,833,408 (GRCm39) missense possibly damaging 0.94
R9317:Dnmt1 UTSW 9 20,829,575 (GRCm39) missense probably damaging 0.99
R9352:Dnmt1 UTSW 9 20,840,384 (GRCm39) missense probably benign 0.00
R9438:Dnmt1 UTSW 9 20,827,190 (GRCm39) missense probably benign
RF003:Dnmt1 UTSW 9 20,821,427 (GRCm39) nonsense probably null
RF004:Dnmt1 UTSW 9 20,821,423 (GRCm39) nonsense probably null
RF011:Dnmt1 UTSW 9 20,821,440 (GRCm39) nonsense probably null
RF011:Dnmt1 UTSW 9 20,821,424 (GRCm39) nonsense probably null
RF015:Dnmt1 UTSW 9 20,821,425 (GRCm39) nonsense probably null
RF015:Dnmt1 UTSW 9 20,821,420 (GRCm39) nonsense probably null
RF017:Dnmt1 UTSW 9 20,821,422 (GRCm39) nonsense probably null
RF023:Dnmt1 UTSW 9 20,821,427 (GRCm39) nonsense probably null
RF024:Dnmt1 UTSW 9 20,821,434 (GRCm39) small insertion probably benign
RF024:Dnmt1 UTSW 9 20,821,426 (GRCm39) nonsense probably null
RF025:Dnmt1 UTSW 9 20,821,431 (GRCm39) nonsense probably null
RF025:Dnmt1 UTSW 9 20,821,416 (GRCm39) nonsense probably null
RF029:Dnmt1 UTSW 9 20,821,419 (GRCm39) nonsense probably null
RF034:Dnmt1 UTSW 9 20,821,416 (GRCm39) nonsense probably null
RF037:Dnmt1 UTSW 9 20,821,437 (GRCm39) nonsense probably null
RF037:Dnmt1 UTSW 9 20,821,429 (GRCm39) nonsense probably null
RF037:Dnmt1 UTSW 9 20,821,415 (GRCm39) critical splice donor site probably benign
RF042:Dnmt1 UTSW 9 20,821,415 (GRCm39) nonsense probably null
RF045:Dnmt1 UTSW 9 20,821,433 (GRCm39) small insertion probably benign
RF045:Dnmt1 UTSW 9 20,821,425 (GRCm39) nonsense probably null
RF047:Dnmt1 UTSW 9 20,821,421 (GRCm39) nonsense probably null
RF048:Dnmt1 UTSW 9 20,821,422 (GRCm39) nonsense probably null
RF055:Dnmt1 UTSW 9 20,821,432 (GRCm39) small insertion probably benign
RF055:Dnmt1 UTSW 9 20,821,431 (GRCm39) nonsense probably null
RF055:Dnmt1 UTSW 9 20,821,424 (GRCm39) nonsense probably null
RF059:Dnmt1 UTSW 9 20,821,434 (GRCm39) small insertion probably benign
RF059:Dnmt1 UTSW 9 20,821,435 (GRCm39) nonsense probably null
RF060:Dnmt1 UTSW 9 20,821,438 (GRCm39) nonsense probably null
RF061:Dnmt1 UTSW 9 20,821,426 (GRCm39) nonsense probably null
X0026:Dnmt1 UTSW 9 20,825,210 (GRCm39) missense probably damaging 1.00
Z1176:Dnmt1 UTSW 9 20,837,850 (GRCm39) missense probably benign 0.00
Z1176:Dnmt1 UTSW 9 20,827,159 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCCTCTGCTGGAACTTAG -3'
(R):5'- CTGGGCAGACACTCTACCTAAAG -3'

Sequencing Primer
(F):5'- CCTCTGCTGGAACTTAGGAAGTGAG -3'
(R):5'- CTTCCTCTGGTGCAGGCTG -3'
Posted On 2019-12-04