Incidental Mutation 'RF054:Nefh'
ID 605209
Institutional Source Beutler Lab
Gene Symbol Nefh
Ensembl Gene ENSMUSG00000020396
Gene Name neurofilament, heavy polypeptide
Synonyms NF-H, NEFH, NF200
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF054 (G1)
Quality Score 217.468
Status Not validated
Chromosome 11
Chromosomal Location 4938754-4948064 bp(-) (GRCm38)
Type of Mutation small insertion (6 aa in frame mutation)
DNA Base Change (assembly) GGGACT to GGGACTGGGCCTCACCTGCGGACT at 4941048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093369]
AlphaFold P19246
Predicted Effect probably benign
Transcript: ENSMUST00000093369
SMART Domains Protein: ENSMUSP00000091061
Gene: ENSMUSG00000020396

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
Filament 94 410 1.45e-109 SMART
low complexity region 470 515 N/A INTRINSIC
Pfam:DUF1388 519 545 1.8e-14 PFAM
Pfam:DUF1388 536 562 5.8e-15 PFAM
Pfam:DUF1388 542 569 2.7e-12 PFAM
Pfam:DUF1388 578 611 9.7e-10 PFAM
Pfam:DUF1388 602 629 4.9e-14 PFAM
Pfam:DUF1388 608 635 4.7e-14 PFAM
Pfam:DUF1388 626 653 1.4e-13 PFAM
Pfam:DUF1388 632 659 2.5e-13 PFAM
Pfam:DUF1388 656 683 4.4e-14 PFAM
Pfam:DUF1388 680 706 1.5e-12 PFAM
Pfam:DUF1388 700 730 5e-12 PFAM
Pfam:DUF1388 728 755 7.9e-14 PFAM
Pfam:DUF1388 752 779 4.7e-14 PFAM
Pfam:DUF1388 779 800 1.9e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 858 948 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
low complexity region 976 1039 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the heavy neurofilament protein. This protein is commonly used as a biomarker of neuronal damage and susceptibility to amyotrophic lateral sclerosis (ALS) has been associated with mutations in this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased axon diameter and transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 CGGC CGGCGGAGGC 18: 36,560,929 probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Dmkn GAAGTGGTGGAAGTGGTGG GAAGTGGTGGAAGTGGTGGAAGTGGTGTAAGTGGTGGAAGTGGTGG 7: 30,767,188 probably benign Het
Dnmt1 CCTCGTT CCTCGTTTTGGGGGCGGAGCACAGTTCCTAGCTCGTT 9: 20,910,139 probably null Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,299,938 probably benign Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm8369 GTGT GTGTCTGT 19: 11,511,764 probably null Het
Lce1m CAC CACCGCTGCGGCGAC 3: 93,018,298 probably benign Het
Lrmp ATTG ATTGAGCACTTTG 6: 145,173,788 probably benign Het
Lypd8 TC TCGCCTCTGTTACCCCACAAATCACCAACACCTCCCCC 11: 58,390,251 probably benign Het
Prp2 CTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCT C 6: 132,600,521 probably null Het
Rassf6 TCACTCATGGTCCTGTAGAGCAATGGGGATTC TCACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCCCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,911 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 CAATGGGGATTC CAATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGAAATGGGGATTC 5: 90,608,931 probably benign Het
Sbp GATGCTGACAACAAA GATGCTGACAACAAATATGCTGACAACAAA 17: 23,945,371 probably benign Het
Six3 GCG GCGCCG 17: 85,621,355 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Thbs1 TGACCTTAG TG 2: 118,122,865 probably benign Het
Tob1 GCA GCACCA 11: 94,214,461 probably benign Het
Ubqln3 AACAC A 7: 104,141,178 probably null Het
Zfhx3 AACAGCAGC AACAGCAGCCACAGCAGC 8: 108,956,096 probably benign Het
Other mutations in Nefh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Nefh APN 11 4941356 missense possibly damaging 0.71
IGL03025:Nefh APN 11 4945289 missense probably damaging 0.99
FR4340:Nefh UTSW 11 4941033 small insertion probably benign
FR4340:Nefh UTSW 11 4941038 small insertion probably benign
FR4340:Nefh UTSW 11 4941040 small insertion probably benign
R0041:Nefh UTSW 11 4945184 missense possibly damaging 0.92
R0149:Nefh UTSW 11 4940799 missense probably benign 0.39
R0361:Nefh UTSW 11 4940799 missense probably benign 0.39
R0531:Nefh UTSW 11 4940240 missense probably damaging 1.00
R1340:Nefh UTSW 11 4941002 small insertion probably benign
R1349:Nefh UTSW 11 4941010 small insertion probably benign
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1469:Nefh UTSW 11 4940066 missense probably benign 0.20
R1564:Nefh UTSW 11 4939878 missense unknown
R2165:Nefh UTSW 11 4943872 missense probably damaging 1.00
R2417:Nefh UTSW 11 4939479 missense unknown
R2906:Nefh UTSW 11 4940216 missense probably benign 0.15
R3750:Nefh UTSW 11 4939937 missense probably benign 0.33
R4298:Nefh UTSW 11 4940066 missense probably benign
R4462:Nefh UTSW 11 4941015 missense probably damaging 0.98
R4713:Nefh UTSW 11 4939656 missense unknown
R4878:Nefh UTSW 11 4941333 missense probably damaging 0.98
R5423:Nefh UTSW 11 4940985 missense possibly damaging 0.59
R5648:Nefh UTSW 11 4945233 missense probably damaging 1.00
R5893:Nefh UTSW 11 4941323 missense probably damaging 1.00
R6459:Nefh UTSW 11 4939551 missense unknown
R7583:Nefh UTSW 11 4941089 missense probably damaging 0.96
R8557:Nefh UTSW 11 4941233 missense probably damaging 0.98
R8925:Nefh UTSW 11 4940530 small deletion probably benign
R8982:Nefh UTSW 11 4947549 missense probably damaging 1.00
R9101:Nefh UTSW 11 4940925 missense probably damaging 0.97
R9291:Nefh UTSW 11 4940871 missense probably benign 0.39
R9576:Nefh UTSW 11 4941222 missense possibly damaging 0.91
R9616:Nefh UTSW 11 4939443 nonsense probably null
R9709:Nefh UTSW 11 4940042 missense probably benign 0.44
R9781:Nefh UTSW 11 4945271 missense probably damaging 1.00
RF001:Nefh UTSW 11 4941030 small insertion probably benign
RF002:Nefh UTSW 11 4941047 small insertion probably benign
RF002:Nefh UTSW 11 4941050 small insertion probably benign
RF009:Nefh UTSW 11 4940997 small insertion probably benign
RF012:Nefh UTSW 11 4941030 small insertion probably benign
RF012:Nefh UTSW 11 4941032 small insertion probably benign
RF012:Nefh UTSW 11 4941055 small insertion probably benign
RF013:Nefh UTSW 11 4941032 small insertion probably benign
RF016:Nefh UTSW 11 4941022 small insertion probably benign
RF016:Nefh UTSW 11 4941023 small insertion probably benign
RF025:Nefh UTSW 11 4941003 small insertion probably benign
RF025:Nefh UTSW 11 4941029 small insertion probably benign
RF028:Nefh UTSW 11 4941012 small insertion probably benign
RF028:Nefh UTSW 11 4941029 small insertion probably benign
RF033:Nefh UTSW 11 4941029 frame shift probably null
RF033:Nefh UTSW 11 4941039 small insertion probably benign
RF035:Nefh UTSW 11 4941039 small insertion probably benign
RF036:Nefh UTSW 11 4941010 small insertion probably benign
RF036:Nefh UTSW 11 4941016 small insertion probably benign
RF036:Nefh UTSW 11 4941036 small insertion probably benign
RF036:Nefh UTSW 11 4941048 small insertion probably benign
RF037:Nefh UTSW 11 4940999 small insertion probably benign
RF037:Nefh UTSW 11 4941046 small insertion probably benign
RF037:Nefh UTSW 11 4941054 small insertion probably benign
RF038:Nefh UTSW 11 4941012 small insertion probably benign
RF038:Nefh UTSW 11 4941018 small insertion probably benign
RF038:Nefh UTSW 11 4941019 small insertion probably benign
RF038:Nefh UTSW 11 4941027 small insertion probably benign
RF038:Nefh UTSW 11 4941029 small insertion probably benign
RF038:Nefh UTSW 11 4941040 small insertion probably benign
RF039:Nefh UTSW 11 4941007 small insertion probably benign
RF041:Nefh UTSW 11 4941039 small insertion probably benign
RF043:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941016 small insertion probably benign
RF044:Nefh UTSW 11 4941021 small insertion probably benign
RF044:Nefh UTSW 11 4941023 small insertion probably benign
RF047:Nefh UTSW 11 4941038 small insertion probably benign
RF048:Nefh UTSW 11 4941003 small insertion probably benign
RF048:Nefh UTSW 11 4941007 small insertion probably benign
RF049:Nefh UTSW 11 4940997 small insertion probably benign
RF051:Nefh UTSW 11 4941054 small insertion probably benign
RF053:Nefh UTSW 11 4941014 nonsense probably null
RF055:Nefh UTSW 11 4941004 small insertion probably benign
RF058:Nefh UTSW 11 4941021 small insertion probably benign
RF060:Nefh UTSW 11 4941050 small insertion probably benign
RF060:Nefh UTSW 11 4941052 small insertion probably benign
RF062:Nefh UTSW 11 4941028 small insertion probably benign
T0975:Nefh UTSW 11 4940151 missense probably benign 0.00
Z1186:Nefh UTSW 11 4940530 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACTGTAGCTGGAGACTTGGG -3'
(R):5'- ATTGGCTTTGGTCCGAGTCC -3'

Sequencing Primer
(F):5'- ACTTGGGCTCAGCTGGTGAC -3'
(R):5'- TCTTACTGAAGGACTCCCAAAAATTC -3'
Posted On 2019-12-04