Incidental Mutation 'R0128:Colec12'
ID 60521
Institutional Source Beutler Lab
Gene Symbol Colec12
Ensembl Gene ENSMUSG00000036103
Gene Name collectin sub-family member 12
Synonyms CL-P1, Scara4, SRCL
MMRRC Submission 038413-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.290) question?
Stock # R0128 (G1)
Quality Score 165
Status Validated
Chromosome 18
Chromosomal Location 9707648-9877995 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 9858921 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 568 (P568L)
Ref Sequence ENSEMBL: ENSMUSP00000043220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040069]
AlphaFold Q8K4Q8
PDB Structure Mouse Scavenger Receptor C-type Lectin carbohydrate-recognition domain. [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000040069
AA Change: P568L
SMART Domains Protein: ENSMUSP00000043220
Gene: ENSMUSG00000036103
AA Change: P568L

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 112 157 N/A INTRINSIC
low complexity region 205 211 N/A INTRINSIC
coiled coil region 217 247 N/A INTRINSIC
low complexity region 268 280 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
Pfam:Collagen 441 499 1.4e-10 PFAM
Pfam:Collagen 482 548 9.6e-10 PFAM
Pfam:Collagen 530 591 3.8e-11 PFAM
CLECT 607 731 4.19e-36 SMART
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. This protein is a scavenger receptor, a cell surface glycoprotein that displays several functions associated with host defense. It can bind to carbohydrate antigens on microorganisms, facilitating their recognition and removal. It also mediates the recognition, internalization, and degradation of oxidatively modified low density lipoprotein by vascular endothelial cells. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,602 (GRCm39) probably benign Het
Abcd4 T G 12: 84,659,126 (GRCm39) Q210P possibly damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Acte1 G T 7: 143,445,492 (GRCm39) G178C probably damaging Het
Actl6b A G 5: 137,553,327 (GRCm39) N113S probably benign Het
Actn3 A T 19: 4,921,643 (GRCm39) V179E probably damaging Het
Aff4 C A 11: 53,306,293 (GRCm39) T1145N probably damaging Het
Ankrd42 G A 7: 92,241,067 (GRCm39) Q431* probably null Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Asap3 C A 4: 135,961,915 (GRCm39) N285K probably damaging Het
Atp6v0a2 A G 5: 124,790,248 (GRCm39) N477S probably damaging Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 (GRCm39) probably null Het
C87436 G A 6: 86,446,809 (GRCm39) G533D probably damaging Het
Ccdc138 T A 10: 58,364,182 (GRCm39) I314N probably damaging Het
Ccs A G 19: 4,875,654 (GRCm39) F237S probably damaging Het
Ccz1 T G 5: 143,946,112 (GRCm39) probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Chd1 A G 17: 17,613,829 (GRCm39) N531S probably damaging Het
Clptm1 A T 7: 19,368,932 (GRCm39) F476I probably damaging Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
D630045J12Rik A T 6: 38,126,706 (GRCm39) probably benign Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dlg1 G T 16: 31,676,883 (GRCm39) probably null Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Ergic3 C A 2: 155,853,060 (GRCm39) R43S possibly damaging Het
Flnb T C 14: 7,901,951 (GRCm38) V938A probably damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Ghrl A T 6: 113,694,129 (GRCm39) probably benign Het
Gm4787 T A 12: 81,424,521 (GRCm39) K546* probably null Het
Gm6576 C G 15: 27,026,086 (GRCm39) noncoding transcript Het
Got1 C T 19: 43,512,816 (GRCm39) D27N probably benign Het
Gucy2c C T 6: 136,681,247 (GRCm39) V946I probably damaging Het
Hectd4 T C 5: 121,487,306 (GRCm39) Y3434H possibly damaging Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Itpr1 A G 6: 108,448,170 (GRCm39) probably benign Het
Kctd1 G A 18: 15,107,237 (GRCm39) P743S probably benign Het
Klhl23 T C 2: 69,664,310 (GRCm39) V553A probably damaging Het
Krt24 T C 11: 99,171,093 (GRCm39) D495G probably damaging Het
L3hypdh C T 12: 72,123,917 (GRCm39) probably null Het
Lipo3 C T 19: 33,534,506 (GRCm39) probably null Het
Lman2l G T 1: 36,463,945 (GRCm39) S171* probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k4 T A 17: 12,466,950 (GRCm39) D1104V probably damaging Het
Mpeg1 T C 19: 12,438,587 (GRCm39) V15A probably benign Het
Narf C T 11: 121,141,662 (GRCm39) R356C probably damaging Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Olfm5 G A 7: 103,810,133 (GRCm39) A76V probably benign Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or52p1 A T 7: 104,267,788 (GRCm39) I301F probably damaging Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Palb2 A T 7: 121,727,389 (GRCm39) Y160* probably null Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pdcd11 G A 19: 47,108,301 (GRCm39) V1223I probably benign Het
Pde6c T C 19: 38,157,813 (GRCm39) probably benign Het
Prr12 A G 7: 44,699,463 (GRCm39) probably benign Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sfr1 A G 19: 47,723,457 (GRCm39) *320W probably null Het
Sft2d1rt A G 11: 45,943,120 (GRCm39) M1T probably null Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Slc1a3 T C 15: 8,665,693 (GRCm39) M519V probably benign Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Spag9 T A 11: 93,984,365 (GRCm39) I327N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Unc79 A G 12: 103,054,693 (GRCm39) probably benign Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Wrap73 A G 4: 154,226,957 (GRCm39) D19G possibly damaging Het
Other mutations in Colec12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Colec12 APN 18 9,848,826 (GRCm39) missense probably damaging 1.00
IGL02477:Colec12 APN 18 9,859,858 (GRCm39) missense unknown
R0130:Colec12 UTSW 18 9,858,921 (GRCm39) missense unknown
R0178:Colec12 UTSW 18 9,858,921 (GRCm39) missense unknown
R0179:Colec12 UTSW 18 9,858,921 (GRCm39) missense unknown
R0180:Colec12 UTSW 18 9,858,921 (GRCm39) missense unknown
R0180:Colec12 UTSW 18 9,848,890 (GRCm39) missense probably damaging 0.99
R0318:Colec12 UTSW 18 9,848,446 (GRCm39) missense possibly damaging 0.77
R0344:Colec12 UTSW 18 9,858,921 (GRCm39) missense unknown
R0573:Colec12 UTSW 18 9,858,650 (GRCm39) missense probably damaging 0.97
R1028:Colec12 UTSW 18 9,866,837 (GRCm39) missense unknown
R1693:Colec12 UTSW 18 9,866,765 (GRCm39) missense unknown
R1951:Colec12 UTSW 18 9,859,975 (GRCm39) critical splice donor site probably null
R2008:Colec12 UTSW 18 9,874,813 (GRCm39) missense probably benign 0.03
R2181:Colec12 UTSW 18 9,846,828 (GRCm39) missense probably damaging 0.99
R4258:Colec12 UTSW 18 9,720,950 (GRCm39) missense probably damaging 1.00
R4794:Colec12 UTSW 18 9,848,984 (GRCm39) missense probably damaging 0.99
R5269:Colec12 UTSW 18 9,846,825 (GRCm39) missense possibly damaging 0.67
R5369:Colec12 UTSW 18 9,866,750 (GRCm39) missense unknown
R5421:Colec12 UTSW 18 9,858,580 (GRCm39) missense probably damaging 1.00
R5608:Colec12 UTSW 18 9,848,267 (GRCm39) missense possibly damaging 0.95
R5668:Colec12 UTSW 18 9,848,963 (GRCm39) missense probably damaging 1.00
R5684:Colec12 UTSW 18 9,849,009 (GRCm39) missense probably damaging 0.99
R6547:Colec12 UTSW 18 9,840,351 (GRCm39) missense probably damaging 1.00
R7194:Colec12 UTSW 18 9,848,248 (GRCm39) missense probably benign 0.08
R7253:Colec12 UTSW 18 9,848,922 (GRCm39) missense probably damaging 1.00
R8492:Colec12 UTSW 18 9,876,980 (GRCm39) splice site probably null
R9365:Colec12 UTSW 18 9,848,146 (GRCm39) missense probably damaging 1.00
R9649:Colec12 UTSW 18 9,877,000 (GRCm39) missense unknown
Z1088:Colec12 UTSW 18 9,848,727 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACCTGGTCCAACTGGCAACAAG -3'
(R):5'- GCCAAGCCTACACACTGCCTTATTC -3'

Sequencing Primer
(F):5'- GGCACAATTGGACCAGTCG -3'
(R):5'- TTCCTCCACAATTCTAGCTGAGAAG -3'
Posted On 2013-07-24