Incidental Mutation 'RF054:Cep131'
ID605212
Institutional Source Beutler Lab
Gene Symbol Cep131
Ensembl Gene ENSMUSG00000039781
Gene Namecentrosomal protein 131
SynonymsAzi1, AZ1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #RF054 (G1)
Quality Score214.458
Status Not validated
Chromosome11
Chromosomal Location120064430-120086827 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) CTGTTGTT to CTGTTGTTGTT at 120072968 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106227] [ENSMUST00000106229] [ENSMUST00000180242]
Predicted Effect probably benign
Transcript: ENSMUST00000106227
SMART Domains Protein: ENSMUSP00000101834
Gene: ENSMUSG00000039781

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 344 N/A INTRINSIC
low complexity region 395 409 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
SCOP:d1jila_ 672 756 2e-3 SMART
low complexity region 785 803 N/A INTRINSIC
low complexity region 813 826 N/A INTRINSIC
coiled coil region 874 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106229
SMART Domains Protein: ENSMUSP00000101836
Gene: ENSMUSG00000039781

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 342 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180242
SMART Domains Protein: ENSMUSP00000136392
Gene: ENSMUSG00000039781

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 345 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoding this gene is a centriolar satellite protein that localizes around the basal body via transport along microtubules. Knockdown in mouse fibroblasts results in a reduction in ciliogenesis. Null mutant mice display no discernible ciliary phenotypes and embryonic patterning and adult homeostasis are largely unaffected. Male mice are infertile, however, due to defects in microtubule trafficking in the sperm manchette and flagella. In addition, the protein binds to a complex of proteins associated with Bardet-Biedl syndrome called the BBSome, and depletion of this protein results in an accumulation of the BBSome in cilia. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit partial preweaning lethality with no apparent defects in cilia formation or function. However, homozygotes display complete male infertility associated with spermiogenesis arrest, severe flagellar defects, and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 CGGC CGGCGGAGGC 18: 36,560,929 probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Dmkn GAAGTGGTGGAAGTGGTGG GAAGTGGTGGAAGTGGTGGAAGTGGTGTAAGTGGTGGAAGTGGTGG 7: 30,767,188 probably benign Het
Dnmt1 CCTCGTT CCTCGTTTTGGGGGCGGAGCACAGTTCCTAGCTCGTT 9: 20,910,139 probably null Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,299,938 probably benign Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm8369 GTGT GTGTCTGT 19: 11,511,764 probably null Het
Lce1m CAC CACCGCTGCGGCGAC 3: 93,018,298 probably benign Het
Lrmp ATTG ATTGAGCACTTTG 6: 145,173,788 probably benign Het
Lypd8 TC TCGCCTCTGTTACCCCACAAATCACCAACACCTCCCCC 11: 58,390,251 probably benign Het
Nefh GGGACT GGGACTGGGCCTCACCTGCGGACT 11: 4,941,048 probably benign Het
Prp2 CTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCT C 6: 132,600,521 probably null Het
Rassf6 TCACTCATGGTCCTGTAGAGCAATGGGGATTC TCACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCCCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,911 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 CAATGGGGATTC CAATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGAAATGGGGATTC 5: 90,608,931 probably benign Het
Sbp GATGCTGACAACAAA GATGCTGACAACAAATATGCTGACAACAAA 17: 23,945,371 probably benign Het
Six3 GCG GCGCCG 17: 85,621,355 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Thbs1 TGACCTTAG TG 2: 118,122,865 probably benign Het
Tob1 GCA GCACCA 11: 94,214,461 probably benign Het
Ubqln3 AACAC A 7: 104,141,178 probably null Het
Zfhx3 AACAGCAGC AACAGCAGCCACAGCAGC 8: 108,956,096 probably benign Het
Other mutations in Cep131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Cep131 APN 11 120077009 missense possibly damaging 0.55
IGL01522:Cep131 APN 11 120067163 missense probably benign 0.09
IGL01524:Cep131 APN 11 120065960 missense probably damaging 1.00
IGL02477:Cep131 APN 11 120070580 missense probably damaging 1.00
R0565:Cep131 UTSW 11 120073762 missense probably damaging 0.97
R1731:Cep131 UTSW 11 120076916 splice site probably null
R1739:Cep131 UTSW 11 120083906 missense probably benign 0.01
R1797:Cep131 UTSW 11 120073736 splice site probably null
R2444:Cep131 UTSW 11 120070495 missense probably damaging 1.00
R2899:Cep131 UTSW 11 120072028 missense probably benign 0.01
R3854:Cep131 UTSW 11 120067185 nonsense probably null
R3856:Cep131 UTSW 11 120067185 nonsense probably null
R4446:Cep131 UTSW 11 120064819 missense probably damaging 1.00
R4624:Cep131 UTSW 11 120070832 missense probably damaging 1.00
R4838:Cep131 UTSW 11 120076156 missense probably damaging 1.00
R4892:Cep131 UTSW 11 120068057 missense probably damaging 0.99
R5170:Cep131 UTSW 11 120070609 missense probably damaging 0.99
R6128:Cep131 UTSW 11 120065975 missense probably damaging 1.00
R6179:Cep131 UTSW 11 120066011 missense probably benign 0.13
R6362:Cep131 UTSW 11 120064690 missense probably damaging 0.99
R6630:Cep131 UTSW 11 120073815 missense probably damaging 1.00
R6786:Cep131 UTSW 11 120065392 missense probably damaging 1.00
R6846:Cep131 UTSW 11 120065691 missense probably damaging 1.00
R6847:Cep131 UTSW 11 120065691 missense probably damaging 1.00
R7210:Cep131 UTSW 11 120064789 missense probably damaging 0.96
R7569:Cep131 UTSW 11 120066713 missense probably damaging 1.00
RF015:Cep131 UTSW 11 120072968 critical splice acceptor site probably benign
Z1177:Cep131 UTSW 11 120065715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCACCTCACTGTAGGCC -3'
(R):5'- AACCTTCTGGAACTGCACCG -3'

Sequencing Primer
(F):5'- TCACTGTAGGCCTCCCAG -3'
(R):5'- AAAAGGCTCGTCAGGCC -3'
Posted On2019-12-04