Incidental Mutation 'RF054:Sbp'
ID605214
Institutional Source Beutler Lab
Gene Symbol Sbp
Ensembl Gene ENSMUSG00000024128
Gene Namespermine binding protein
Synonymsp25
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #RF054 (G1)
Quality Score217.468
Status Not validated
Chromosome17
Chromosomal Location23941672-23945607 bp(+) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) GATGCTGACAACAAA to GATGCTGACAACAAATATGCTGACAACAAA at 23945371 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024940] [ENSMUST00000181985] [ENSMUST00000182519] [ENSMUST00000182868] [ENSMUST00000183017] [ENSMUST00000183155] [ENSMUST00000183252]
Predicted Effect probably benign
Transcript: ENSMUST00000024940
SMART Domains Protein: ENSMUSP00000024940
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181985
SMART Domains Protein: ENSMUSP00000138422
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182519
SMART Domains Protein: ENSMUSP00000138338
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:Jacalin 26 87 3e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182868
SMART Domains Protein: ENSMUSP00000138491
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Jacalin 53 178 2.32e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183017
Predicted Effect probably benign
Transcript: ENSMUST00000183155
SMART Domains Protein: ENSMUSP00000138341
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183252
SMART Domains Protein: ENSMUSP00000138219
Gene: ENSMUSG00000024128

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Jacalin 26 151 2.32e-15 SMART
low complexity region 161 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 CGGC CGGCGGAGGC 18: 36,560,929 probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Dmkn GAAGTGGTGGAAGTGGTGG GAAGTGGTGGAAGTGGTGGAAGTGGTGTAAGTGGTGGAAGTGGTGG 7: 30,767,188 probably benign Het
Dnmt1 CCTCGTT CCTCGTTTTGGGGGCGGAGCACAGTTCCTAGCTCGTT 9: 20,910,139 probably null Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,299,938 probably benign Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm8369 GTGT GTGTCTGT 19: 11,511,764 probably null Het
Lce1m CAC CACCGCTGCGGCGAC 3: 93,018,298 probably benign Het
Lrmp ATTG ATTGAGCACTTTG 6: 145,173,788 probably benign Het
Lypd8 TC TCGCCTCTGTTACCCCACAAATCACCAACACCTCCCCC 11: 58,390,251 probably benign Het
Nefh GGGACT GGGACTGGGCCTCACCTGCGGACT 11: 4,941,048 probably benign Het
Prp2 CTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCT C 6: 132,600,521 probably null Het
Rassf6 TCACTCATGGTCCTGTAGAGCAATGGGGATTC TCACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCCCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,911 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 CAATGGGGATTC CAATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGAAATGGGGATTC 5: 90,608,931 probably benign Het
Six3 GCG GCGCCG 17: 85,621,355 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Thbs1 TGACCTTAG TG 2: 118,122,865 probably benign Het
Tob1 GCA GCACCA 11: 94,214,461 probably benign Het
Ubqln3 AACAC A 7: 104,141,178 probably null Het
Zfhx3 AACAGCAGC AACAGCAGCCACAGCAGC 8: 108,956,096 probably benign Het
Other mutations in Sbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Sbp APN 17 23945348 utr 3 prime probably benign
IGL02035:Sbp APN 17 23942612 missense possibly damaging 0.73
FR4449:Sbp UTSW 17 23945364 small insertion probably benign
FR4737:Sbp UTSW 17 23945382 small insertion probably benign
FR4737:Sbp UTSW 17 23945389 small insertion probably benign
R0457:Sbp UTSW 17 23945312 missense probably benign 0.04
R1083:Sbp UTSW 17 23942730 splice site probably benign
R1544:Sbp UTSW 17 23945069 missense probably benign 0.01
R2075:Sbp UTSW 17 23945158 splice site probably null
R3741:Sbp UTSW 17 23945582 utr 3 prime probably benign
R4513:Sbp UTSW 17 23945312 missense probably benign 0.04
R4774:Sbp UTSW 17 23945244 missense probably damaging 1.00
R5338:Sbp UTSW 17 23942422 start gained probably benign
R5576:Sbp UTSW 17 23945578 missense probably benign 0.05
R7315:Sbp UTSW 17 23945306 missense probably benign 0.10
R7894:Sbp UTSW 17 23942189 intron probably benign
R7977:Sbp UTSW 17 23942189 intron probably benign
RF003:Sbp UTSW 17 23945369 small insertion probably benign
RF010:Sbp UTSW 17 23945351 small insertion probably benign
RF011:Sbp UTSW 17 23945354 small insertion probably benign
RF024:Sbp UTSW 17 23945387 small insertion probably benign
RF037:Sbp UTSW 17 23945384 small insertion probably benign
RF037:Sbp UTSW 17 23945387 small insertion probably benign
RF038:Sbp UTSW 17 23945384 small insertion probably benign
RF042:Sbp UTSW 17 23945384 small insertion probably benign
RF044:Sbp UTSW 17 23945366 small insertion probably benign
RF048:Sbp UTSW 17 23945389 small insertion probably benign
RF056:Sbp UTSW 17 23945366 small insertion probably benign
RF059:Sbp UTSW 17 23945377 small insertion probably benign
RF061:Sbp UTSW 17 23945377 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTGACACTGGAGGTTCAGAC -3'
(R):5'- CTCAGGCTCACATAGATGCAC -3'

Sequencing Primer
(F):5'- GTTCAGACAAGCATCTAGTGACTGTC -3'
(R):5'- GGCATTTGGGCTTTGCTCCC -3'
Posted On2019-12-04