Incidental Mutation 'RF054:Six3'
ID 605216
Institutional Source Beutler Lab
Gene Symbol Six3
Ensembl Gene ENSMUSG00000038805
Gene Name sine oculis-related homeobox 3
Synonyms E130112M24Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF054 (G1)
Quality Score 153.468
Status Not validated
Chromosome 17
Chromosomal Location 85921036-85933619 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) GCG to GCGCCG at 85928783 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162695] [ENSMUST00000175898] [ENSMUST00000176081]
AlphaFold Q62233
Predicted Effect probably benign
Transcript: ENSMUST00000162695
SMART Domains Protein: ENSMUSP00000125169
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175898
SMART Domains Protein: ENSMUSP00000135677
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176081
SMART Domains Protein: ENSMUSP00000135312
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 51 92 N/A INTRINSIC
Pfam:SIX1_SD 109 223 6e-47 PFAM
HOX 229 290 6.5e-17 SMART
low complexity region 315 331 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sine oculis homeobox transcription factor family. The encoded protein plays a role in eye development. Mutations in this gene have been associated with holoprosencephaly type 2. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with anterior structures of the head and brain undeveloped. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 CGGC CGGCGGAGGC 18: 36,693,982 (GRCm39) probably benign Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 119,963,794 (GRCm39) probably benign Het
Chga AGC AGCTGC 12: 102,527,682 (GRCm39) probably benign Het
Dmkn GAAGTGGTGGAAGTGGTGG GAAGTGGTGGAAGTGGTGGAAGTGGTGTAAGTGGTGGAAGTGGTGG 7: 30,466,613 (GRCm39) probably benign Het
Dnmt1 CCTCGTT CCTCGTTTTGGGGGCGGAGCACAGTTCCTAGCTCGTT 9: 20,821,435 (GRCm39) probably null Het
Epha8 CCTGGGC CC 4: 136,660,348 (GRCm39) probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,433,010 (GRCm39) probably benign Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 71,314,022 (GRCm39) probably benign Het
Gm8369 GTGT GTGTCTGT 19: 11,489,128 (GRCm39) probably null Het
Irag2 ATTG ATTGAGCACTTTG 6: 145,119,514 (GRCm39) probably benign Het
Lce1m CAC CACCGCTGCGGCGAC 3: 92,925,605 (GRCm39) probably benign Het
Lypd8 TC TCGCCTCTGTTACCCCACAAATCACCAACACCTCCCCC 11: 58,281,077 (GRCm39) probably benign Het
Nefh GGGACT GGGACTGGGCCTCACCTGCGGACT 11: 4,891,048 (GRCm39) probably benign Het
Prp2 CTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCT C 6: 132,577,484 (GRCm39) probably null Het
Rassf6 TCACTCATGGTCCTGTAGAGCAATGGGGATTC TCACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCCCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,756,770 (GRCm39) probably benign Het
Rassf6 CAATGGGGATTC CAATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGAAATGGGGATTC 5: 90,756,790 (GRCm39) probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,756,783 (GRCm39) probably benign Het
Sbp GATGCTGACAACAAA GATGCTGACAACAAATATGCTGACAACAAA 17: 24,164,345 (GRCm39) probably benign Het
Tfeb CAG CAGTAG 17: 48,097,023 (GRCm39) probably null Het
Thbs1 TGACCTTAG TG 2: 117,953,346 (GRCm39) probably benign Het
Tob1 GCA GCACCA 11: 94,105,287 (GRCm39) probably benign Het
Ubqln3 AACAC A 7: 103,790,385 (GRCm39) probably null Het
Zfhx3 AACAGCAGC AACAGCAGCCACAGCAGC 8: 109,682,728 (GRCm39) probably benign Het
Other mutations in Six3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03096:Six3 APN 17 85,929,365 (GRCm39) missense possibly damaging 0.78
IGL03397:Six3 APN 17 85,929,074 (GRCm39) missense probably damaging 1.00
FR4304:Six3 UTSW 17 85,928,796 (GRCm39) small insertion probably benign
FR4340:Six3 UTSW 17 85,928,784 (GRCm39) small insertion probably benign
FR4449:Six3 UTSW 17 85,928,790 (GRCm39) small insertion probably benign
FR4548:Six3 UTSW 17 85,928,791 (GRCm39) small insertion probably benign
FR4589:Six3 UTSW 17 85,928,793 (GRCm39) small insertion probably benign
FR4737:Six3 UTSW 17 85,928,786 (GRCm39) small insertion probably benign
FR4737:Six3 UTSW 17 85,928,785 (GRCm39) small insertion probably benign
FR4737:Six3 UTSW 17 85,928,796 (GRCm39) small insertion probably benign
FR4737:Six3 UTSW 17 85,928,793 (GRCm39) small insertion probably benign
FR4737:Six3 UTSW 17 85,928,791 (GRCm39) small insertion probably benign
FR4737:Six3 UTSW 17 85,928,790 (GRCm39) small insertion probably benign
FR4976:Six3 UTSW 17 85,928,799 (GRCm39) small insertion probably benign
FR4976:Six3 UTSW 17 85,928,786 (GRCm39) small insertion probably benign
R0238:Six3 UTSW 17 85,928,818 (GRCm39) missense probably damaging 1.00
R1264:Six3 UTSW 17 85,929,285 (GRCm39) missense probably damaging 0.96
R2903:Six3 UTSW 17 85,931,283 (GRCm39) missense probably damaging 0.96
R2916:Six3 UTSW 17 85,929,061 (GRCm39) missense probably benign 0.25
R4994:Six3 UTSW 17 85,928,720 (GRCm39) missense possibly damaging 0.91
R5393:Six3 UTSW 17 85,931,270 (GRCm39) missense possibly damaging 0.93
R6524:Six3 UTSW 17 85,929,398 (GRCm39) missense probably damaging 1.00
R8998:Six3 UTSW 17 85,931,164 (GRCm39) missense probably benign 0.01
R8999:Six3 UTSW 17 85,931,164 (GRCm39) missense probably benign 0.01
RF003:Six3 UTSW 17 85,928,798 (GRCm39) small insertion probably benign
RF010:Six3 UTSW 17 85,928,783 (GRCm39) small insertion probably benign
RF011:Six3 UTSW 17 85,928,796 (GRCm39) small insertion probably benign
RF012:Six3 UTSW 17 85,928,796 (GRCm39) small insertion probably benign
RF014:Six3 UTSW 17 85,928,784 (GRCm39) small insertion probably benign
RF015:Six3 UTSW 17 85,928,798 (GRCm39) small insertion probably benign
RF022:Six3 UTSW 17 85,928,784 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCGCTGAATCTTGACTCGG -3'
(R):5'- GTTTGTTGATGGCCTCGCAC -3'

Sequencing Primer
(F):5'- GTGGGTGTCCCTTACGTCC -3'
(R):5'- CGATGTCGCCCGTCTCC -3'
Posted On 2019-12-04