Incidental Mutation 'RF054:Six3'
ID605216
Institutional Source Beutler Lab
Gene Symbol Six3
Ensembl Gene ENSMUSG00000038805
Gene Namesine oculis-related homeobox 3
SynonymsE130112M24Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF054 (G1)
Quality Score153.468
Status Not validated
Chromosome17
Chromosomal Location85613608-85629302 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GCG to GCGCCG at 85621355 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162695] [ENSMUST00000175898] [ENSMUST00000176081]
Predicted Effect probably benign
Transcript: ENSMUST00000162695
SMART Domains Protein: ENSMUSP00000125169
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175898
SMART Domains Protein: ENSMUSP00000135677
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176081
SMART Domains Protein: ENSMUSP00000135312
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 51 92 N/A INTRINSIC
Pfam:SIX1_SD 109 223 6e-47 PFAM
HOX 229 290 6.5e-17 SMART
low complexity region 315 331 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sine oculis homeobox transcription factor family. The encoded protein plays a role in eye development. Mutations in this gene have been associated with holoprosencephaly type 2. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with anterior structures of the head and brain undeveloped. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 CGGC CGGCGGAGGC 18: 36,560,929 probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Dmkn GAAGTGGTGGAAGTGGTGG GAAGTGGTGGAAGTGGTGGAAGTGGTGTAAGTGGTGGAAGTGGTGG 7: 30,767,188 probably benign Het
Dnmt1 CCTCGTT CCTCGTTTTGGGGGCGGAGCACAGTTCCTAGCTCGTT 9: 20,910,139 probably null Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
F830016B08Rik AAAAAA AAAAAAAAA 18: 60,299,938 probably benign Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm8369 GTGT GTGTCTGT 19: 11,511,764 probably null Het
Lce1m CAC CACCGCTGCGGCGAC 3: 93,018,298 probably benign Het
Lrmp ATTG ATTGAGCACTTTG 6: 145,173,788 probably benign Het
Lypd8 TC TCGCCTCTGTTACCCCACAAATCACCAACACCTCCCCC 11: 58,390,251 probably benign Het
Nefh GGGACT GGGACTGGGCCTCACCTGCGGACT 11: 4,941,048 probably benign Het
Prp2 CTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCT C 6: 132,600,521 probably null Het
Rassf6 TCACTCATGGTCCTGTAGAGCAATGGGGATTC TCACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCCCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,911 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 CAATGGGGATTC CAATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGAAATGGGGATTC 5: 90,608,931 probably benign Het
Sbp GATGCTGACAACAAA GATGCTGACAACAAATATGCTGACAACAAA 17: 23,945,371 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Thbs1 TGACCTTAG TG 2: 118,122,865 probably benign Het
Tob1 GCA GCACCA 11: 94,214,461 probably benign Het
Ubqln3 AACAC A 7: 104,141,178 probably null Het
Zfhx3 AACAGCAGC AACAGCAGCCACAGCAGC 8: 108,956,096 probably benign Het
Other mutations in Six3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03096:Six3 APN 17 85621937 missense possibly damaging 0.78
IGL03397:Six3 APN 17 85621646 missense probably damaging 1.00
FR4304:Six3 UTSW 17 85621368 small insertion probably benign
FR4340:Six3 UTSW 17 85621356 small insertion probably benign
FR4449:Six3 UTSW 17 85621362 small insertion probably benign
FR4548:Six3 UTSW 17 85621363 small insertion probably benign
FR4589:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621357 small insertion probably benign
FR4737:Six3 UTSW 17 85621358 small insertion probably benign
FR4737:Six3 UTSW 17 85621362 small insertion probably benign
FR4737:Six3 UTSW 17 85621363 small insertion probably benign
FR4737:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621368 small insertion probably benign
FR4976:Six3 UTSW 17 85621358 small insertion probably benign
FR4976:Six3 UTSW 17 85621371 small insertion probably benign
R0238:Six3 UTSW 17 85621390 missense probably damaging 1.00
R1264:Six3 UTSW 17 85621857 missense probably damaging 0.96
R2903:Six3 UTSW 17 85623855 missense probably damaging 0.96
R2916:Six3 UTSW 17 85621633 missense probably benign 0.25
R4994:Six3 UTSW 17 85621292 missense possibly damaging 0.91
R5393:Six3 UTSW 17 85623842 missense possibly damaging 0.93
R6524:Six3 UTSW 17 85621970 missense probably damaging 1.00
RF003:Six3 UTSW 17 85621370 small insertion probably benign
RF010:Six3 UTSW 17 85621355 small insertion probably benign
RF011:Six3 UTSW 17 85621368 small insertion probably benign
RF012:Six3 UTSW 17 85621368 small insertion probably benign
RF014:Six3 UTSW 17 85621356 small insertion probably benign
RF015:Six3 UTSW 17 85621370 small insertion probably benign
RF022:Six3 UTSW 17 85621356 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCGCTGAATCTTGACTCGG -3'
(R):5'- GTTTGTTGATGGCCTCGCAC -3'

Sequencing Primer
(F):5'- GTGGGTGTCCCTTACGTCC -3'
(R):5'- CGATGTCGCCCGTCTCC -3'
Posted On2019-12-04