Mutagenetix > Incidental Mutation

Incidental Mutation 'RF054:Ankhd1'

605217

Institutional Source

Beutler Lab

Gene Symbol

Ankhd1

Ensembl Gene

ENSMUSG00000024483

Gene Name

ankyrin repeat and KH domain containing 1

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

RF054 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

36559987-36665917 bp(+) (GRCm38)

Type of Mutation

small insertion (2 aa in frame mutation)

DNA Base Change (assembly)

CGGC to CGGCGGAGGC at 36560929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000123270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]

AlphaFold

E9PUR0

Predicted Effect

probably benign
Transcript: ENSMUST00000006205

SMART Domains

Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134146

SMART Domains

Protein: ENSMUSP00000122136
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
low complexity region	17	35	N/A	INTRINSIC
ANK	140	169	2.11e2	SMART
ANK	173	202	3.31e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142977

SMART Domains

Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000155329

SMART Domains

Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2342	2362	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.3%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Predicted Effect	Zygosity
Bean1	CT	C	8: 104,182,032	probably null	Het
Cep131	CTGTTGTT	CTGTTGTTGTT	11: 120,072,968	probably benign	Het
Chga	AGC	AGCTGC	12: 102,561,423	probably benign	Het
Dmkn	GAAGTGGTGGAAGTGGTGG	GAAGTGGTGGAAGTGGTGGAAGTGGTGTAAGTGGTGGAAGTGGTGG	7: 30,767,188	probably benign	Het
Dnmt1	CCTCGTT	CCTCGTTTTGGGGGCGGAGCACAGTTCCTAGCTCGTT	9: 20,910,139	probably null	Het
Epha8	CCTGGGC	CC	4: 136,933,037	probably benign	Het
F830016B08Rik	AAAAAA	AAAAAAAAA	18: 60,299,938	probably benign	Het
Gabre	TCAGGCTCAGGCT	TCAGGCTCAGGCTCAGGCT	X: 72,270,416	probably benign	Het
Gm8369	GTGT	GTGTCTGT	19: 11,511,764	probably null	Het
Lce1m	CAC	CACCGCTGCGGCGAC	3: 93,018,298	probably benign	Het
Lrmp	ATTG	ATTGAGCACTTTG	6: 145,173,788	probably benign	Het
Lypd8	TC	TCGCCTCTGTTACCCCACAAATCACCAACACCTCCCCC	11: 58,390,251	probably benign	Het
Nefh	GGGACT	GGGACTGGGCCTCACCTGCGGACT	11: 4,941,048	probably benign	Het
Prp2	CTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCT	C	6: 132,600,521	probably null	Het
Rassf6	TCACTCATGGTCCTGTAGAGCAATGGGGATTC	TCACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCCCACTCATGGTCCTGTAGAGCAATGGGGATTC	5: 90,608,911	probably benign	Het
Rassf6	TGTAGAGCAATGGGGATTC	TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC	5: 90,608,924	probably benign	Het
Rassf6	CAATGGGGATTC	CAATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGAAATGGGGATTC	5: 90,608,931	probably benign	Het
Sbp	GATGCTGACAACAAA	GATGCTGACAACAAATATGCTGACAACAAA	17: 23,945,371	probably benign	Het
Six3	GCG	GCGCCG	17: 85,621,355	probably benign	Het
Tfeb	CAG	CAGTAG	17: 47,786,098	probably null	Het
Thbs1	TGACCTTAG	TG	2: 118,122,865	probably benign	Het
Tob1	GCA	GCACCA	11: 94,214,461	probably benign	Het
Ubqln3	AACAC	A	7: 104,141,178	probably null	Het
Zfhx3	AACAGCAGC	AACAGCAGCCACAGCAGC	8: 108,956,096	probably benign	Het

Other mutations in Ankhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ankhd1	APN	18	36665459	unclassified	probably benign
IGL00927:Ankhd1	APN	18	36632072	missense	probably benign	0.01
IGL01367:Ankhd1	APN	18	36578643	missense	probably benign	0.16
IGL01624:Ankhd1	APN	18	36658013	missense	probably damaging	1.00
IGL01725:Ankhd1	APN	18	36648153	missense	probably benign	0.04
IGL01767:Ankhd1	APN	18	36648374	missense	probably damaging	1.00
IGL02005:Ankhd1	APN	18	36648426	missense	probably damaging	1.00
IGL02009:Ankhd1	APN	18	36624661	missense	probably damaging	1.00
IGL02246:Ankhd1	APN	18	36656726	missense	probably damaging	1.00
IGL02336:Ankhd1	APN	18	36594814	missense	probably damaging	0.97
IGL02628:Ankhd1	APN	18	36647703	missense	probably benign	0.00
IGL02644:Ankhd1	APN	18	36578775	critical splice donor site	probably null
IGL02735:Ankhd1	APN	18	36648546	missense	probably benign	0.00
IGL02877:Ankhd1	APN	18	36594823	missense	probably damaging	1.00
IGL03129:Ankhd1	APN	18	36658008	nonsense	probably null
IGL03163:Ankhd1	APN	18	36647628	missense	probably damaging	0.97
IGL03182:Ankhd1	APN	18	36578774	missense	probably benign	0.06
IGL03184:Ankhd1	APN	18	36647777	missense	probably damaging	1.00
IGL03398:Ankhd1	APN	18	36656837	splice site	probably benign
FR4304:Ankhd1	UTSW	18	36560924	small insertion	probably benign
R0051:Ankhd1	UTSW	18	36647188	unclassified	probably benign
R0089:Ankhd1	UTSW	18	36640356	missense	probably damaging	0.99
R0105:Ankhd1	UTSW	18	36646766	missense	probably damaging	1.00
R0149:Ankhd1	UTSW	18	36647214	missense	probably damaging	1.00
R0243:Ankhd1	UTSW	18	36634734	missense	probably damaging	1.00
R0322:Ankhd1	UTSW	18	36658008	nonsense	probably null
R0361:Ankhd1	UTSW	18	36647214	missense	probably damaging	1.00
R0389:Ankhd1	UTSW	18	36644599	missense	possibly damaging	0.48
R0418:Ankhd1	UTSW	18	36634300	missense	probably damaging	1.00
R0443:Ankhd1	UTSW	18	36644599	missense	possibly damaging	0.48
R0540:Ankhd1	UTSW	18	36640280	missense	probably damaging	1.00
R0607:Ankhd1	UTSW	18	36640280	missense	probably damaging	1.00
R0738:Ankhd1	UTSW	18	36645249	splice site	probably benign
R1127:Ankhd1	UTSW	18	36634346	missense	probably damaging	1.00
R1434:Ankhd1	UTSW	18	36625159	missense	probably benign	0.09
R1742:Ankhd1	UTSW	18	36625265	missense	probably damaging	1.00
R1776:Ankhd1	UTSW	18	36647308	missense	probably benign	0.17
R1856:Ankhd1	UTSW	18	36644527	missense	probably benign	0.00
R1923:Ankhd1	UTSW	18	36648030	missense	probably benign	0.08
R2044:Ankhd1	UTSW	18	36645113	missense	probably benign	0.31
R2112:Ankhd1	UTSW	18	36641626	missense	probably damaging	1.00
R2115:Ankhd1	UTSW	18	36634308	missense	probably damaging	1.00
R2136:Ankhd1	UTSW	18	36647621	missense	probably benign
R2196:Ankhd1	UTSW	18	36648379	missense	probably damaging	1.00
R2291:Ankhd1	UTSW	18	36644333	missense	probably benign	0.31
R2305:Ankhd1	UTSW	18	36642926	missense	possibly damaging	0.59
R2309:Ankhd1	UTSW	18	36624765	missense	probably damaging	1.00
R2519:Ankhd1	UTSW	18	36578543	splice site	probably null
R2958:Ankhd1	UTSW	18	36634729	missense	probably damaging	1.00
R3978:Ankhd1	UTSW	18	36647613	missense	probably damaging	0.96
R3980:Ankhd1	UTSW	18	36647613	missense	probably damaging	0.96
R4159:Ankhd1	UTSW	18	36589540	missense	possibly damaging	0.91
R4199:Ankhd1	UTSW	18	36661048	unclassified	probably benign
R4323:Ankhd1	UTSW	18	36578633	missense	probably damaging	1.00
R4356:Ankhd1	UTSW	18	36643043	nonsense	probably null
R4496:Ankhd1	UTSW	18	36560786	missense	probably damaging	0.98
R4551:Ankhd1	UTSW	18	36655507	splice site	probably null
R4590:Ankhd1	UTSW	18	36583644	missense	probably damaging	1.00
R4667:Ankhd1	UTSW	18	36648021	missense	possibly damaging	0.77
R4889:Ankhd1	UTSW	18	36578734	missense	probably null	0.00
R4923:Ankhd1	UTSW	18	36589452	missense	probably damaging	1.00
R5091:Ankhd1	UTSW	18	36625027	missense	possibly damaging	0.68
R5254:Ankhd1	UTSW	18	36656715	missense	probably benign	0.05
R5314:Ankhd1	UTSW	18	36561058	splice site	probably null
R5336:Ankhd1	UTSW	18	36646716	missense	probably damaging	1.00
R5367:Ankhd1	UTSW	18	36589408	missense	probably damaging	1.00
R5384:Ankhd1	UTSW	18	36591495	missense	probably damaging	1.00
R5385:Ankhd1	UTSW	18	36591495	missense	probably damaging	1.00
R5387:Ankhd1	UTSW	18	36634644	missense	probably damaging	1.00
R5458:Ankhd1	UTSW	18	36648485	missense	probably benign	0.01
R5599:Ankhd1	UTSW	18	36560807	missense	probably damaging	0.98
R5659:Ankhd1	UTSW	18	36561050	missense	probably damaging	1.00
R5750:Ankhd1	UTSW	18	36624902	missense	probably benign	0.00
R5874:Ankhd1	UTSW	18	36640269	missense	possibly damaging	0.92
R5894:Ankhd1	UTSW	18	36647524	missense	probably damaging	0.99
R5969:Ankhd1	UTSW	18	36600834	missense	probably damaging	1.00
R6133:Ankhd1	UTSW	18	36625126	missense	possibly damaging	0.77
R6190:Ankhd1	UTSW	18	36611809	missense	possibly damaging	0.84
R6247:Ankhd1	UTSW	18	36654146	missense	probably benign	0.00
R6512:Ankhd1	UTSW	18	36591456	missense	probably damaging	1.00
R6649:Ankhd1	UTSW	18	36600783	splice site	probably null
R6653:Ankhd1	UTSW	18	36600783	splice site	probably null
R6763:Ankhd1	UTSW	18	36642969	missense	probably benign	0.31
R6976:Ankhd1	UTSW	18	36648254	missense	probably benign	0.00
R7075:Ankhd1	UTSW	18	36559989	missense
R7208:Ankhd1	UTSW	18	36625028	missense	probably benign
R7305:Ankhd1	UTSW	18	36632205	missense
R7615:Ankhd1	UTSW	18	36656773	missense
R7654:Ankhd1	UTSW	18	36594101	missense	probably damaging	1.00
R7781:Ankhd1	UTSW	18	36625205	missense	probably damaging	1.00
R7842:Ankhd1	UTSW	18	36647828	missense	probably benign	0.00
R7965:Ankhd1	UTSW	18	36658412	missense
R8006:Ankhd1	UTSW	18	36648719	missense
R8037:Ankhd1	UTSW	18	36638623	missense	probably damaging	0.98
R8123:Ankhd1	UTSW	18	36575083	missense
R8195:Ankhd1	UTSW	18	36654177	missense
R8305:Ankhd1	UTSW	18	36647166	missense	possibly damaging	0.79
R8708:Ankhd1	UTSW	18	36594291	missense	probably damaging	1.00
R8827:Ankhd1	UTSW	18	36624580	nonsense	probably null
R9138:Ankhd1	UTSW	18	36560908	small deletion	probably benign
R9139:Ankhd1	UTSW	18	36578757	missense
R9186:Ankhd1	UTSW	18	36634330	missense	possibly damaging	0.95
R9245:Ankhd1	UTSW	18	36655600	missense
R9254:Ankhd1	UTSW	18	36644627	missense	probably benign	0.03
R9262:Ankhd1	UTSW	18	36632746	missense
R9379:Ankhd1	UTSW	18	36644627	missense	probably benign	0.03
R9436:Ankhd1	UTSW	18	36560988	missense	probably benign	0.39
R9436:Ankhd1	UTSW	18	36641601	missense	probably benign	0.04
R9541:Ankhd1	UTSW	18	36624644	missense
R9584:Ankhd1	UTSW	18	36665451	missense	probably benign	0.06
R9664:Ankhd1	UTSW	18	36647825	missense	probably benign	0.03
RF001:Ankhd1	UTSW	18	36560921	small insertion	probably benign
RF004:Ankhd1	UTSW	18	36560910	small insertion	probably benign
RF007:Ankhd1	UTSW	18	36560909	small insertion	probably benign
RF008:Ankhd1	UTSW	18	36560924	small insertion	probably benign
RF009:Ankhd1	UTSW	18	36560922	small insertion	probably benign
RF013:Ankhd1	UTSW	18	36560926	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36560909	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36560910	small insertion	probably benign
RF017:Ankhd1	UTSW	18	36560909	small insertion	probably benign
RF018:Ankhd1	UTSW	18	36560912	small insertion	probably benign
RF026:Ankhd1	UTSW	18	36560912	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36560913	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36560927	small insertion	probably benign
RF039:Ankhd1	UTSW	18	36560918	small insertion	probably benign
RF043:Ankhd1	UTSW	18	36560917	small insertion	probably benign
RF046:Ankhd1	UTSW	18	36560926	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36560917	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36560923	small insertion	probably benign
RF049:Ankhd1	UTSW	18	36560923	small insertion	probably benign
RF050:Ankhd1	UTSW	18	36560927	small insertion	probably benign
RF057:Ankhd1	UTSW	18	36560929	small insertion	probably benign
RF060:Ankhd1	UTSW	18	36560922	small insertion	probably benign
RF061:Ankhd1	UTSW	18	36560921	small insertion	probably benign
RF062:Ankhd1	UTSW	18	36560918	small insertion	probably benign
X0027:Ankhd1	UTSW	18	36624832	missense	probably damaging	1.00
X0065:Ankhd1	UTSW	18	36578764	nonsense	probably null
X0066:Ankhd1	UTSW	18	36646704	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGAACCATGCTGACGGAC -3'
(R):5'- TGCTGTCAGAGAACACTGC -3'

Sequencing Primer
(F):5'- CTGACGGACAGCGGGGG -3'
(R):5'- TGCGGGTCCAAAGAATTCC -3'

Posted On

2019-12-04