Incidental Mutation 'RF054:F830016B08Rik'
ID605218
Institutional Source Beutler Lab
Gene Symbol F830016B08Rik
Ensembl Gene ENSMUSG00000090942
Gene NameRIKEN cDNA F830016B08 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #RF054 (G1)
Quality Score214.458
Status Not validated
Chromosome18
Chromosomal Location60293380-60303016 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) AAAAAA to AAAAAAAAA at 60299938 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171297]
Predicted Effect probably benign
Transcript: ENSMUST00000171297
SMART Domains Protein: ENSMUSP00000131437
Gene: ENSMUSG00000090942

DomainStartEndE-ValueType
Pfam:IIGP 35 405 1.1e-131 PFAM
Pfam:ABC_tran 68 214 7.3e-7 PFAM
Pfam:MMR_HSR1 71 197 2.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 CGGC CGGCGGAGGC 18: 36,560,929 probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep131 CTGTTGTT CTGTTGTTGTT 11: 120,072,968 probably benign Het
Chga AGC AGCTGC 12: 102,561,423 probably benign Het
Dmkn GAAGTGGTGGAAGTGGTGG GAAGTGGTGGAAGTGGTGGAAGTGGTGTAAGTGGTGGAAGTGGTGG 7: 30,767,188 probably benign Het
Dnmt1 CCTCGTT CCTCGTTTTGGGGGCGGAGCACAGTTCCTAGCTCGTT 9: 20,910,139 probably null Het
Epha8 CCTGGGC CC 4: 136,933,037 probably benign Het
Gabre TCAGGCTCAGGCT TCAGGCTCAGGCTCAGGCT X: 72,270,416 probably benign Het
Gm8369 GTGT GTGTCTGT 19: 11,511,764 probably null Het
Lce1m CAC CACCGCTGCGGCGAC 3: 93,018,298 probably benign Het
Lrmp ATTG ATTGAGCACTTTG 6: 145,173,788 probably benign Het
Lypd8 TC TCGCCTCTGTTACCCCACAAATCACCAACACCTCCCCC 11: 58,390,251 probably benign Het
Nefh GGGACT GGGACTGGGCCTCACCTGCGGACT 11: 4,941,048 probably benign Het
Prp2 CTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCT C 6: 132,600,521 probably null Het
Rassf6 TCACTCATGGTCCTGTAGAGCAATGGGGATTC TCACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCCCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,911 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 CAATGGGGATTC CAATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGAAATGGGGATTC 5: 90,608,931 probably benign Het
Sbp GATGCTGACAACAAA GATGCTGACAACAAATATGCTGACAACAAA 17: 23,945,371 probably benign Het
Six3 GCG GCGCCG 17: 85,621,355 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Thbs1 TGACCTTAG TG 2: 118,122,865 probably benign Het
Tob1 GCA GCACCA 11: 94,214,461 probably benign Het
Ubqln3 AACAC A 7: 104,141,178 probably null Het
Zfhx3 AACAGCAGC AACAGCAGCCACAGCAGC 8: 108,956,096 probably benign Het
Other mutations in F830016B08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:F830016B08Rik APN 18 60300268 missense probably damaging 1.00
IGL02642:F830016B08Rik APN 18 60299986 missense probably benign 0.00
FR4342:F830016B08Rik UTSW 18 60299941 small insertion probably benign
R0172:F830016B08Rik UTSW 18 60299964 missense possibly damaging 0.64
R0375:F830016B08Rik UTSW 18 60300193 missense probably damaging 1.00
R1517:F830016B08Rik UTSW 18 60300898 nonsense probably null
R1791:F830016B08Rik UTSW 18 60300517 missense probably benign 0.01
R2413:F830016B08Rik UTSW 18 60300293 nonsense probably null
R2696:F830016B08Rik UTSW 18 60300736 missense possibly damaging 0.75
R3607:F830016B08Rik UTSW 18 60300708 nonsense probably null
R4612:F830016B08Rik UTSW 18 60301015 missense probably benign 0.42
R4621:F830016B08Rik UTSW 18 60300867 missense probably benign 0.01
R4752:F830016B08Rik UTSW 18 60301081 missense probably benign 0.00
R5755:F830016B08Rik UTSW 18 60300806 missense probably damaging 1.00
R5909:F830016B08Rik UTSW 18 60300019 missense probably damaging 1.00
R6183:F830016B08Rik UTSW 18 60299877 missense probably benign 0.00
R6272:F830016B08Rik UTSW 18 60300078 missense probably damaging 1.00
R7076:F830016B08Rik UTSW 18 60300471 missense probably damaging 1.00
R8130:F830016B08Rik UTSW 18 60299980 missense probably benign 0.00
R8171:F830016B08Rik UTSW 18 60300078 missense possibly damaging 0.94
R8289:F830016B08Rik UTSW 18 60300288 missense probably benign 0.45
RF044:F830016B08Rik UTSW 18 60299938 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTCAGGTTAGATGTAACACATTAGCTC -3'
(R):5'- CATTGATGAGGCTGGATTTTCC -3'

Sequencing Primer
(F):5'- GAGCTTTTCTCATCCAAAAGGACTG -3'
(R):5'- TGGATTTTCCAGCTCCAGAC -3'
Posted On2019-12-04